Question: splitting paired end fastq reads on galaxy
gravatar for Vin
9 months ago by
JNCASR, Bangalore, India
Vin0 wrote:

Hi, I'm new to galaxy. While working on a paired end data set, I noticed that there is only one fastq file for both mate pairs unlike when using fatq-dump --split-3, you get two fastq files. I tried running fastq-splitter, but the example there doesn't suit my purpose. Am I doing it wrong? Please help.

My fastq file -

@HWUSI-EAS053R_0012:6:1:1041:13363/1 CGCTGTCTCANGGGGTGCATCTACCCAGCA +SRR925740.1 HWUSI-EAS053R_0012:6:1:1041:13363 length=35 FDFFDDDDDB%C@>AC@?CCDDCEEE=DE= @HWUSI-EAS053R_0012:6:1:1041:13363/2 GTGGAGGACTTCGTGAAGGATTCGGGCGCC +SRR925740.1 HWUSI-EAS053R_0012:6:1:1041:13363 length=35 ECEEEDEB=DE@EBED-DC5BBAE5B=BB@

Thank you.

fastq paired-end rna-seq • 249 views
ADD COMMENTlink written 9 months ago by Vin0
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 82 users visited in the last hour