Question: splitting paired end fastq reads on galaxy
0
gravatar for Vin
18 months ago by
Vin0
JNCASR, Bangalore, India
Vin0 wrote:

Hi, I'm new to galaxy. While working on a paired end data set, I noticed that there is only one fastq file for both mate pairs unlike when using fatq-dump --split-3, you get two fastq files. I tried running fastq-splitter, but the example there doesn't suit my purpose. Am I doing it wrong? Please help.

My fastq file -

@HWUSI-EAS053R_0012:6:1:1041:13363/1 CGCTGTCTCANGGGGTGCATCTACCCAGCA +SRR925740.1 HWUSI-EAS053R_0012:6:1:1041:13363 length=35 FDFFDDDDDB%C@>AC@?CCDDCEEE=DE= @HWUSI-EAS053R_0012:6:1:1041:13363/2 GTGGAGGACTTCGTGAAGGATTCGGGCGCC +SRR925740.1 HWUSI-EAS053R_0012:6:1:1041:13363 length=35 ECEEEDEB=DE@EBED-DC5BBAE5B=BB@

Thank you.

fastq paired-end rna-seq • 484 views
ADD COMMENTlink written 18 months ago by Vin0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 145 users visited in the last hour