Barcode Splitter Problem

Question: Barcode Splitter Problem

5.3 years ago by

Hi all, I need some serious help i got output from the Miseq machine in fastq file format. My supevisor asked me to separate barcodes, so since monday i have been struggling to use this in command- line and executed it but either there is some mistake that it doesnt recognize any barcodes at all and does not give me out text file just puts it all in one file called unmatched.I then just to try tried the convert the fastq to fasta command and it said cannot execute the binary file....i broke my head so i tried other commands all said cannot execute binary file... Q1..so first kindly tell me why any of these binary files cant be executed from the root directory? and what extra software do i have to download more then what was within the installation instructions. So i turned to the galaxy web based usage which was all the more harder i could not figure out in the barcode splitter program what the library to split actually require at first i thought the document with barcodes so i uploaded but this thing just does not show anything in the pulldown for library to split. Its thursday and i have to still trim the fastq sequences and nothing seems to work at all with what i am working ....can some body please help me...... Sincerely, Piyu

galaxy • 2.0k views

ADD COMMENT • link •

modified 5.3 years ago by Jennifer Hillman Jackson ♦ 25k • written 5.3 years ago by Priyanka Vengurlekar • 10

5.3 years ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hi Piyu, Sorry to hear that you are having problems. The barcode splitter tools requires two inputs and each must be labeled correctly when using the tool in the UI (datatype assignment - using pencil icon or at upload). Binaray/compressed files are not permitted in the Galaxy UI (or when using the Galaxy wrapped tool command-line) as input. If you need to uncompress your data, Galaxy will do this upon upload for most types, but on the command-line you'll need to use the extension as a clue then find/use the appropriate command (should be easy to find online). Test out in UI a sample, then run line command if you want. These are the requirements: *Barcode file* - text tabular delimited file that looks like this and has a datatype assignment of "tabular". #mybarcodes codeA TCATAGACGAAGACGGACTAG codeB CTAGCAGCAGTCAGCATCAGA codeC ATCTCGCATACGCAGGCATCG *FASTQ/A input file* - fastq file with a datatype assignment of ".fastq" or a variation such as ".fastqsanger". Also accepts ".fasta". This help section and the next can help more: http://wiki.galaxyproject.org/Support#Tool_doesn.27t_recognize_dataset Best, Jen Galaxy team -- Jennifer Hillman-Jackson http://galaxyproject.org

ADD COMMENT • link written 5.3 years ago by Jennifer Hillman Jackson ♦ 25k

Similar posts • Search »