Question: Splitting pair end file
0
gravatar for jramo033
12 months ago by
jramo03320
jramo03320 wrote:

This is the type of file for pair end DNA sequence I have:

@MONK:275:C1Y6RACXX:1:1101:1169:1943/1 
NAATAAATACTCTAAGACAAATCTATCACTTTAAAAGAGAGAAATCATATTCTAGGTTTTCATTAATGTCAGACTTAGCAGTGAAGATTCTCAGGTTCCT
+
#4=DFFFFHHHHHJJJJJJIIIJJJJJIJJJJIJJJJIJGJGIJJJJIIJJJJIJJHIJJJJJJJIIJIGIIIJJHIIFIJHHHHHHFFFFFFFEEEEED 
@MONK:275:C1Y6RACXX:1:1101:1169:1943/2 
CAAATAAATACTCTAAGACAAAACTTGAATATAGAAAGTTGTAGAGGGTTTTTAGAAATTGATTTATAATACTTACAAATGATGAGTCTGAAAGAAGCCAAG
+ 
CB@@DDFFFHHHHHJIIIJJJJJJJJJFHJGIHHHGIHGHIHIHHIHJ?GHDGHIIIJIJJIIJIJJIIJJIJIJIJIIHFHHGEFCEFFFFEEDEEDDCDA

I need help to split the file in right and reverse reading. The number of reading is not the same (100 vs 102) so I was thinking in using Manipulate FASTQ. Can you help me how to write the code so that at the end I can have two separate files?

fastq paired split • 922 views
ADD COMMENTlink modified 12 months ago by Jennifer Hillman Jackson25k • written 12 months ago by jramo03320
0
gravatar for Jennifer Hillman Jackson
12 months ago by
United States
Jennifer Hillman Jackson25k wrote:

Hello,

Please see this FAQ for how to split the data:

Thanks! Jen, Galaxy team

ADD COMMENTlink modified 12 months ago • written 12 months ago by Jennifer Hillman Jackson25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 173 users visited in the last hour