Question: Barcode Splitting
0
gravatar for Rajarshi Ghosh
6.0 years ago by
Rajarshi Ghosh • 10 wrote:
I have lllumina sequences which are barcoded in the sequence identifier e.g.: @FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1 CTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGAAAA ATTGTTTTGTGACCTCTCTC The '#TCGCAGGA" is the barcode. As the barcode is not on the 5' or 3' end I cannot use the barcode splitter. Is there a workaround in Galaxy for this? Thanks!
galaxy • 1.4k views
ADD COMMENT • link • modified 6.0 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.0 years ago by Rajarshi Ghosh • 10
0
gravatar for Philipe Moncuquet
6.0 years ago by
Australia
Philipe Moncuquet • 40 wrote:
Hi, How comes the barcode not be at 5' or 3' end, do you have primer sequences or stuff like that ? The barcode you show cannot be found in the sequence you show... I know that FastqMCF is an alternative tool that can be found in the toolshed and that deals with barcode. Philippe 2012/12/3 Rajarshi Ghosh <rajarshi@princeton.edu>
ADD COMMENT • link written 6.0 years ago by Philipe Moncuquet • 40
0
gravatar for Jennifer Hillman Jackson
6.0 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hi Rajarshi, How many barcodes do you have? If just a few, then the 'Filter and Sort -> Select' tool might be a good choice. This will do about the same thing as the "grep" in the top answer at Biostar, for the same type of question: http://www.biostars.org/p/15446/ I did check the tool shed and didn't find any tools that would do this. Maybe also post a inquiry galaxy-dev@bx.psu.edu and see if someone has developed a tool that will demultiplex fastq sequences with barcodes in the identifier, but hasn't loaded it into the tool shed yet? You could also open a request to have such a tool created (or the current barcode tool expanded): http://wiki.galaxyproject.org/Support#Trello_Issue_Board Good luck! Jen Galaxy team -- Jennifer Jackson http://galaxyproject.org
ADD COMMENT • link written 6.0 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 173 users visited in the last hour