Question: Preprocessing Gdna Illumina Paired End Data For Mapping/Snp Calling
0
gravatar for Timothy Brennan
5.6 years ago by
Timothy Brennan • 10 wrote:
This question is w/ regards to pre-processing whole genome resequencing data for mapping data to a reference yeast strain. I'm having trouble joining paired end data. I have two files per sample (read1 and read2). I've successfully uploaded my fastq.gz files into galaxy using FTP. I have two fastq files for each direction per strain labelled for example: (for the left hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.1.fastq (for the right hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.2.fastq Now once I groom each using FASTQ Groomer I'm trying to join them to get a single file and I'm joining 0% of the reads. So I think the header or directory is not in the correct format. E.g., the raw groomed reads for the left hand and right hand look like: (for the left hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.1.fastq @HWI-ST1240:133:H0854ADXX:2:1101:2716:1998 1:N:0:CCGTCC NGTATGGAAGACGTAGAGTGGATGAAAATTTTGTGAAAAAAAAAAGCTTATAGGAACAAAAACATCCTTA CATCTTCGGGTATTTCTTCTAGGGTTGAAGT + !!!%%%%%)))))**(*(!$()(((***(***')(**********)'))%!!%&%$$$$$####$$$$$$ "$!!""!!##!!!!$$%$""!!"#$#!!!!! @HWI-ST1240:133:H0854ADXX:2:1101:5045:1994 1:N:0:CCGTCC NCCAGACACAGTTAACGCAACCTGACATGCAACAGTTATCGGGTTCTTGTGGTTTTGCAGGCACTTGGAC ACCTGCTATTTTCTTCGTTCCGCCGCTAAGC (for the right hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.2.fastq @HWI-ST1240:133:H0854ADXX:2:1101:2716:1998 2:N:0:CCGTCC GCATAGTTACTTTTTGATCACTAACAACGATATATTATCGTTGAACAATTTACTACGCAAAACAGTTCAC GTGATGTACGTCAGATAATTCACTGAAGGTA + $$$''''')))))++++++(+++++++++++++++++*+*++*++++++++++*++++*+++++*))))) )''''&'&'%&%%%%$%%%'&%%%%%$%%$! @HWI-ST1240:133:H0854ADXX:2:1101:5045:1994 2:N:0:CCGTCC ATGTATTATAAGCCCGAATCAGATACTCAAATTTGAAAAAAGATATCTTTCTCCTCCGACATGGCCGAAC TCATTTACATAAATAGCATAAATTAAACAGA According to the wiki I think the fastq format should look something like this with /1 and /2 corresponding the each paired file. @61CC3AAXX100125:7:118:2538:5577/1 GACACCTTTAATGTCTGAAAAGAGACATTCACCATCTATTCTCTTGGAGGGCTACCACCTAAGAGCCTTC ATCCCC + ?>CADFEEEBEDIEHHIDGGGEEEEHFFGIGIIFFIIEFHIIIIHIIFFIIIDEIIGIIIEHFFFIIEHI FA@?== @61CC3AAXX100125:7:1:17320:13701/1 CTCAGAAGACCCTGAGAACATGTGCCCAAGGTGGTCACAGTGCATCTTAGTTTTGTACATTTTAGGGAGA TATGAG + ?BCAAADBBGGHGIDDDGHFEIFIIIIFGEIFIIFIGIGEFIIGGIIHEFFHHHIHEIFGHHIEFIIEEC E?>@89 Any suggestions on how to get the files in the correct format/header to be able to join them? Last question, what is the tool to trim reads based on quality again? Thanks very much gentle people Tim
galaxy • 1.3k views
ADD COMMENT • link • modified 5.6 years ago by Jennifer Hillman Jackson ♦ 25k • written 5.6 years ago by Timothy Brennan • 10
0
gravatar for Jennifer Hillman Jackson
5.6 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello Tim, Yes, this is a known issue, a few of the tools do not function with sequences with the newer formatted identifiers. There is a bare-bones Trello ticket for the upgrade, but to be honest, this hasn't been prioritized because of so few use cases: https://trello.com/c/bhurghHk After running "FASTQ Groomer", doing some QC is a good idea by running "FastQC", then " FASTQ Trimmer" or "FASTQ Quality Trimmer" are options. From there, just proceed with mapping. You can always filter the mapping results to restrict hits to those resulting from property paired data after (See "NGS: SAM Tools -> Filter SAM") or certain other tools will have this as an option on the downstream tool form itself. So, you don't need to filter twice with respect to pairs - once at the end is generally considered OK as long as the input data all meet some minimum quality thresholds (to optimally map with the given tool/parameters and avoid processing problems). Hopefully this helps, Jen Galaxy team -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org
ADD COMMENT • link written 5.6 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 172 users visited in the last hour