Question: How can I do trimming off to all nucleotide sequences that end with a specific sequence in my illumine reads?!
0
gravatar for dina.hany
19 months ago by
dina.hany • 0
dina.hany • 0 wrote:

Hello everyone,

I am new to Galaxy and I was wondering if anybody knows how can I trim all sequences that ends with a certain base sequences in my illumina reads?! for example, if i have this read: NTGTGGAAAGGACGAAACACCGTAATGGGTGGCGTTACTGGCGTTTTAGA and I want to trim off the bolded sequences from left till the CACCG sequence.

I will appreciate any help.

Thank you in advance.

Dina Hany

trimming fastq • 589 views
ADD COMMENT • link • modified 19 months ago by Jennifer Hillman Jackson ♦ 25k • written 19 months ago by dina.hany • 0
0
gravatar for Jennifer Hillman Jackson
19 months ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:

Hi Dina,

The fastq QA/trimming tools available at http://usegalaxy.org are:

NGS: QC and manipulation

  • Trimmomatic flexible read trimming tool for Illumina NGS data
  • Trim Galore! adaptive quality and adapter trimmer
  • Trim sequences
  • FASTQ Trimmer by column
  • FASTQ Quality Trimmer by sliding window

Each will trim with slightly different results. Please review the tools forms, try a few out, and determine the one that is the best fit for your data. The tool FastQC can be used to evaluate the results before and after QA/trimming.

Help: https://galaxyproject.org/tutorials/ngs/#fastq-manipulation-and-quality-control

Thanks! Jen, Galaxy team

ADD COMMENT • link written 19 months ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 173 users visited in the last hour