Question: Way to trim all NGS nucleotide sequences to a specific section
0
gravatar for c.l.frankling
12 months ago by
c.l.frankling • 10 wrote:

Is there a way to trim the nucleotide sequence to a specific region? I know you can by base number but what if say for instance I would like to trim to just the open reading frame e.g.

TATAGAAGGGTAATACGACTCACTATAGGGAGTCGCTGCCATGGCCTTGAAAGCCCATCTCGTAACGCCATCATTGGGAGGAGGA

and I want to trim everything before the ATG off so that it becomes;

ATGGCCTTGAAAGCCCATCTCGTAACGCCATCATTGGGAGGAGGA

This will be a different base position in most of the sequences so I couldn't instance trim off position 1-40. Is there a tool where you can tell it trim all sequences to the region starting with ATGGCC??

Many thanks,

Charlotte Frankling.

ADD COMMENT • link • modified 12 months ago by Jennifer Hillman Jackson ♦ 25k • written 12 months ago by c.l.frankling • 10
0
gravatar for Jennifer Hillman Jackson
12 months ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:

Hello,

The regular trimming tools won't do this exact operation, but the tool Text Manipulation > Replace Text in entire line could be used. This would be appropriate for fasta formatted data where the sequence lines are not wrapped (use FASTA Width formatter as needed), but not fastq.

Hope that helps! Jen, Galaxy team

ADD COMMENT • link written 12 months ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 171 users visited in the last hour