Question: How To Clip Multiple Adapter Sequences In Penn State Galaxy? Thank.
0
gravatar for Binbin You
6.4 years ago by
Binbin You50
Binbin You50 wrote:
Hi All, In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip.  In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. So how could i do if  I have the adapter sequences like this:                           5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much  for any response! Best wishes, Bin
galaxy • 1.5k views
ADD COMMENTlink modified 6.4 years ago by Jennifer Hillman Jackson24k • written 6.4 years ago by Binbin You50
0
gravatar for Jennifer Hillman Jackson
6.4 years ago by
United States
Jennifer Hillman Jackson24k wrote:
Hi Bin, The reply given for this same question posted at seqanswers is correct, including the Tool Shed comments: http://seqanswers.com/forums/showthread.php?t=14106 To give a bit more detail, when using the public Galaxy instance at http://usegalaxy.org, the idea would be to run the "NGS: QC and manipulation -> Clip" tool with each adapter, one at a time. Each time start with the same original file and only output sequences that are clipped. Then merge at the end, if wanted, for downstream analysis. The Clip tool is sourced from the FASTX-toolkit and currently does only work for 3' adapters. You may want to contact the tool author Assaf Gordon if you have a suggestions/use cases for tool enhancements http://hannonlab.cshl.edu/fastx_toolkit/. Just so you know, there are tools that simply trim off bases, from either end, which may or may not work for needs. Please see "FASTQ Trimmer" and "Trim sequences". I also opened a bitbucket ticket to track the ideas for expanding the options for this type of function. This can be tracked at: http://bitbucket.org/galaxy/galaxy-central/issue/659/expand-adapter- sequence-clipping-options Hopefully one of the available options will work out for your project, Best, Jen Galaxy team -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support
ADD COMMENTlink written 6.4 years ago by Jennifer Hillman Jackson24k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 107 users visited in the last hour