Question: Clip Adapter Sequences
0
gravatar for Fransisc Raul Kantor
6.9 years ago by
Fransisc Raul Kantor • 10 wrote:
Hi We're a bit confused about exactly how the adaptor clipping tool works. Is there some documentation that describes how it does the clipping? In the clipping example given on the Galaxy page for "Clip adapter sequences" (the adaptor is CTGTAGGCACCATCATTATTTATATAA ): * How large a substring of the sequence must the adaptor be in order for it to be clipped? E.g., if the sequence is ATGGACTCTG, it seems to clip the terminal CTG, but it doesn't clip if CTG appears somewhere in the middle of a sequence. * Does it clip if, say, the middle part of the adaptor appears somewhere in the middle of a sequence, and if so, how long must it be before it clips? Thank you, Francisc Raul Kantor
galaxy • 1.8k views
ADD COMMENT • link • modified 6.9 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.9 years ago by Fransisc Raul Kantor • 10
0
gravatar for Jennifer Hillman Jackson
6.9 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello Francisc, The Clip tool is sourced from the FASTX-tool kit, so specific edge- case behavior should be tested out or directed at the team that developed the tool at: http://hannonlab.cshl.edu/fastx_toolkit/index.html http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper _usage This is true for 3' clipping, because the adaptor leads with a CTG and the sequence ends with a CTG. The orientation is correct and the sequence's terminal CTG is clipped. Clipping off or introducing mismatches at the ends of an adaptor (up to 3 in a 10 base adaptor) still found and clipped in my test. More along these lines should narrow down the criteria or the tool authors can clarify. Best wishes, Jen Galaxy team -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/wiki/Support
ADD COMMENT • link written 6.9 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 171 users visited in the last hour