Question: Fastx Clipper On Fastq Data
0
gravatar for Michael Walter
7.8 years ago by
Michael Walter • 20 wrote:
Hi List, I have a couple of miRNA-Seq files (Illumina GAIIx, 29nt read length). These reads contain differing amounts of 3' adapter sequences and therefore map really badly to the human genome (with eland v2). Therefore, I'd like to use the FastX clipper tool, which states that "This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file." However, After uploading my fastq files and converting it to Sanger format, the clipper does not accept the fastq file as input. After converting it to fasta it works fine. However, the mapping tools will only accept fastq files. So my question is, is there a way to clip the adapter directly in the fastq file (we have a local installation of galaxy, so I may also use command line options)? Thank you very much for your input, Mike -- Dr. Michael Walter MFT Services University of Tübingen Calwerstr. 7 72076 Tübingen Tel.: +49 7071 29 83210 Fax. + 49 7071 29 5228 web: www.mft-services.de Confidentiality Note: This message is intended only for the use of the named recipient(s) and may contain confidential and/or proprietary information. If you are not the intended recipient, please contact the sender and delete the message. Any unauthorized use of the information contained in this message is prohibite d.
galaxy • 1.7k views
ADD COMMENT • link • modified 7.8 years ago by Peter Cock • 1.4k • written 7.8 years ago by Michael Walter • 20
0
gravatar for Peter Cock
7.8 years ago by
Peter Cock • 1.4k
European Union
Peter Cock • 1.4k wrote:
On Thu, Feb 17, 2011 at 10:06 AM, Michael Walter Hi Mike, Is your input FASTQ file definitely marked as type fastqsanger (not just fastq)? The fasta_clipper.xml says it will take fasta,fastqsanger,fastqsolexa,fastqillumina and is (now) aware that it should use the -Q 33 switch on Sanger FASTQ, see: https://bitbucket.org/galaxy/galaxy- central/src/default/tools/fastx_toolkit/fastx_clipper.xml Notice however that it does not accept the generic "fastq" Galaxy format (which I think would also include color-space FASTQ). Peter
ADD COMMENT • link written 7.8 years ago by Peter Cock • 1.4k
Dear Peter, Thanks for the quick reply. But yes, the groomer output was marked as fastqsanger. I changed to generic fastq and back and it didn't work either way. I only get the fasta files from my history as possible input files. However, using the local installation via command line seemed to work (fastx_clipper -a TGGAATTCTCGGGTGCCAAGG -l 15 -n -v -i s_1_sequence.txt -o s_1_sequence_clipped.txt) Kind regards, Mike -- Dr. Michael Walter MFT Services University of Tübingen Calwerstr. 7 72076  Tübingen Tel.: +49 7071 29 83210 Fax. + 49 7071 29 5228 web: www.mft-services.de Confidentiality Note: This message is intended only for the use of the named reci pient(s) and may contain confidential and/or proprietary information. If you are  not the intended recipient, please contact the sender and delete the message.  Any unauthorized use of the information contained in this message is prohibite d. Von: "Peter Cock" <p.j.a.cock@googlemail.com> Gesendet: 17.02.2011 11:44:01 An: "Michael Walter" <michael.walter@med.uni-tuebingen.de> Betreff: Re: [galaxy-user] FastX Clipper on FastQ data
ADD REPLY • link written 7.8 years ago by Michael Walter • 20
Hi Mike, I was able to select fastqsanger files from one of my histories at our public server. If you are using the public server, can you share your history with me and I will check if there is a reason you are unable to select these datasets. If you are trying this on your local instance, can you make sure it is running up-to-date Galaxy code? Thanks for using Galaxy, Dan
ADD REPLY • link written 7.8 years ago by Daniel Blankenberg ♦♦ 1.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 172 users visited in the last hour