Question: Extracting Alignments From Multiz With Refseq Annotation
0
gravatar for Vesselin Baev
10.7 years ago by
Vesselin Baev50 wrote:
Dear all, I'm wondering when I extract a alignments with coorfinates (for refseqs) from Multiz from genome-wide alignments I can make fasta MAFs with info-line with coordinates but never looking like this: 122200029 122200071 + 154141344 rn3.chr5 143135020 143135060 + 173106704 canFam1.chr15 6850518 6850559 + 67237905 CCTGCCCCTATTGTAAGTCAATTAATA-AAAAGAGCCATCTGG CTTGCCTCTATGATAAACCAGTTAATATAAAAGTGTCACATGG CTTGCCTCTGTTATAAGCCACTTAATA--AAAGTGTCACATGG CCTGCCTCTCATAGGAAGCAAGTAATG-AAAAGAGCCATCTGG 14280459 14280491 - 154141344 rn3.chr5 12802003 12802032 - 173106704 canFam1.chr2 5413700 5413729 - 87725193 GCCGGCCCAGCAAGATGAAACAG---GGCACCC GTCAGCCTGGGGGGGGTCGGCAGCCTGGCACCC GTCAGCCTGG---GAGTCGGCAGCCTGGCGCCC GCCAGCCCAGCAAGATGAAACAG---GGTGGCC How to make this? I have failed trying do this... Vesko -- Dr. Vesselin Baev University of Plovdiv Dept. Molecular Biology Bioinformatics Group Tzar Assen 24 Plovdiv 4000, BULGARIA 032/ 261 (534) 089/ 43 80 945 Skype: vesselin_baev vebaev@gmail.com baev@uni-plovdiv.bg
• 756 views
ADD COMMENTlink modified 10.6 years ago by Daniel Blankenberg ♦♦ 1.7k • written 10.7 years ago by Vesselin Baev50
0
gravatar for Daniel Blankenberg
10.6 years ago by
Daniel Blankenberg ♦♦ 1.7k
United States
Daniel Blankenberg ♦♦ 1.7k wrote:
Hi Vesko, I'm not sure what you are trying to do here. Let us know if you can provide more information about why you need this specific format arrangement. Dan
ADD COMMENTlink written 10.6 years ago by Daniel Blankenberg ♦♦ 1.7k
Hi, my task is automatically to make (not 1 by 1, namualy) an alignment of 3'UTRs of a 300 genes, I have the list of acc.numbers and/or names of them. When I do the MAFs I cannot see which blocks are from one UTR/gene/name.... Vesko 2008/4/16, Daniel Blankenberg <dan@bx.psu.edu>: -- Dr. Vesselin Baev University of Plovdiv Dept. Molecular Biology Bioinformatics Group Tzar Assen 24 Plovdiv 4000, BULGARIA 032/ 261 (534) 089/ 43 80 945 Skype: vesselin_baev vebaev@gmail.com baev@uni-plovdiv.bg
ADD REPLYlink written 10.6 years ago by Vesselin Baev50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 179 users visited in the last hour