Cufflinks Analysis Using .Bam Files Generated By Lifescope (Abi 5500 Sequencer)

Question: Cufflinks Analysis Using .Bam Files Generated By Lifescope (Abi 5500 Sequencer)

6.0 years ago by

Hello, I am new in using Galaxy and I am working on .bam files generated by our sequencing platform, using the LifeScope software associated to ABI 5500 sequencer. I uploaded my files on a galaxy browser ( http://galaxy.raetschlab.org) and I tried to run cufflink assemble and quantify reads expression levels for each file. However, when I run cufflinks (using default parameters) the output is an empty file. What is going wrong? Should I use special parameters? Are the .bam files generated by LifeScope suitable for cufflink analysis or should I transform the xsq ABI output in a fastq and then apply TopHat? I thank you very much for your help Davide Davide Degli Esposti, PhD Epigenetic (EGE) Group International Agency for Research on Cancer Tel. +33 4 72738036 Fax. +33 4 72738322 150, cours Albert Thomas 69372 Lyon Cedex 08 France This message and its attachments are strictly confidential. If you are not the intended recipient of this message, please immediately notify the sender and delete it. Since its integrity cannot be guaranteed, its content cannot involve the sender's responsibility. Any misuse, any disclosure or publication of its content, either whole or partial, is prohibited, exception made of formally approved use

rna-seq cufflinks • 1.1k views

ADD COMMENT • link •

modified 6.0 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.0 years ago by Davide Degli Esposti • 80

6.0 years ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hello Davide, The fact that you are not getting any error points to some problem with the input. Perhaps you are sending just sequence data in BAM format to Cufflinks, without any alignment performed first? Some sort of error would be expected for most other cases, but this is not the Galaxy server our team hosts, it is difficult to state exactly what the issue may be, just offer suggestions. Tophat will require fastq files as input, unless this alternate Galaxy site has a modified wrapper. Then the alignments generated by Tophat (or another alignment tool, sometimes Bowtie is used) in BAM format are the input to Cuffinks (along with other optional data). If your data are aligned BAM, and you continue to have problems with this alternate Galaxy site, it would be best to contact the group that runs it - the information is on their home page (middle panel) when you follow the url. You could also decide to use the public Galaxy instance run by our core project team at http://usegalaxy.org, if we have the tool set you wish to use. A generalized tutorial for RNA-seq analysis is available here: http://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise And some troubleshooting help here: http://wiki.galaxyproject.org/Support#Tools_on_the_Main_server The tool author's original documentation would be good to review as well: http://tophat.cbcb.umd.edu http://cufflinks.cbcb.umd.edu Best, Jen Galaxy team -- Jennifer Jackson http://galaxyproject.org

ADD COMMENT • link written 6.0 years ago by Jennifer Hillman Jackson ♦ 25k

6.0 years ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hello Davide, If the data does represent alignments (not just sequence), then there is one more item to check for. Another team member reminded me that Cufflinks requires an "XS" custom tag in an input SAM file (or any compressed BAM file that represents it). Details are here from the Cufflinks manual: http://cufflinks.cbcb.umd.edu/manual.html#cufflinks_input : -- Cufflinks takes a text file of SAM alignments, or a binary SAM (BAM) file as input. For more details on the SAM format, see the specification <http: samtools.sourceforge.net="" sam1.pdf="">. The RNA-Seq read mapper TopHat <http: tophat.cbcb.umd.edu=""/> produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept: s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it *must* be present for all spliced alignment records (those with a 'N' operation in the CIGAR string). This should be fairly easy to check for now that the data is in uncompressed SAM format. Running the pipeline starting with Tophat may be the best choice. If you using the public Main server and have continued problems not covered in our tutorial/FAQ, a bug report can be submitted from error datasets: http://wiki.galaxyproject.org/Support#Reporting_tool_errors Hopefully this helps, Jen Galaxy team -- Jennifer Jackson http://galaxyproject.org

ADD COMMENT • link written 6.0 years ago by Jennifer Hillman Jackson ♦ 25k

Please log in to add an answer.

Similar posts • Search »