Question: Fetching Promoters
0
gravatar for Linda Barnum
8.9 years ago by
Linda Barnum60
Linda Barnum60 wrote:
Hello, Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser? Thanks, Lin
• 983 views
ADD COMMENTlink modified 8.9 years ago by Anton Nekrutenko1.7k • written 8.9 years ago by Linda Barnum60
0
gravatar for Anton Nekrutenko
8.9 years ago by
Penn State
Anton Nekrutenko1.7k wrote:
Linda: Suppose you want to fetch sequences of homologous promoters for all Drosophila genes. Here is an outline of how to do this: 1. Download coordinates of flybase genes from Drosophila melanogaster dm2 genome build (see attached images 1 and 2). 2. Use "Operate on Genomic Intervals -> Get Flanks" to convert coordinates of genes into coordinates of putative promoters by taking 500 bp upstream of each gene (see attached images 3). 3. Use "Fetch alignments -> Stitch MAF blocks" to retrieve homologous sequences for several species (see attached image 4). You will get alignments in FASTA format corresponding to your promoters. They will look like this: CAAAGAGCGTCTCTCCGTCATCTCTATTCACGGCGTAGACCGTGAACCCGTAGCCGG CAAAAAGCGTCTCTCCGTCATCTCTTTTTACGGCGTATGCGGTGAATCCGTACCCGG CAAAGAGCGTCTCGCCGTCGGAGCGCTGGACAGCGTAGGCGGTGAAGCCATAACCAG Let us know you have problems. Thanks, anton galaxy team
ADD COMMENTlink written 8.9 years ago by Anton Nekrutenko1.7k
Hi Linda, Multiz 15-way alignments for dm3 are now available for use on the test instance of Galaxy located at http://test.g2.bx.psu.edu/. They'll be made available on our main server shortly. Thanks, Guru Galaxy team. Guruprasad Ananda Graduate Student Bioinformatics and Genomics The Pennsylvania State University
ADD REPLYlink written 8.9 years ago by Guruprasad Ananda230
0
gravatar for Anton Nekrutenko
8.9 years ago by
Penn State
Anton Nekrutenko1.7k wrote:
Yes. This will be happening shortly. a. Anton Nekrutenko http://nekrut.bx.psu.edu http://galaxyproject.org
ADD COMMENTlink written 8.9 years ago by Anton Nekrutenko1.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 178 users visited in the last hour