Question: Run Bowtie To Estimate Mean Inner Distance Between Mate Pairs
0
gravatar for Du, Jianguang
6.3 years ago by
Du, Jianguang • 380
Du, Jianguang • 380 wrote:
Dear All, In order to figure out the Mean Inner Distance between Mate Pairs of my paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina) with both forward and reverse datasets and mouse mm9 as reference genome. Below I list the Bowtie output for only one pair of reads (I put the fields on the left side): For the forward read QNAME: SRR322837.8.1 FLAG: 99 RNAME: chr1 POS: 163761156 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761301 ISIZE: 181 SEQ: NTGGATACTATTTTGCCATAAAAAAATGAATAAAAT QUAL: %(,,')(())@@@2235885<<22222@@@###### OPT: XA:i:1 MD:Z:0A35 NM:i:1 For the reverse read QNAME: SRR322837.8.2 FLAG: 147 RNAME: chr1 POS: 163761301 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761156 ISIZE: -181 SEQ: TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA QUAL: GDBE@B>EEGDB=BD-=GG>GGGEDDG<gbgd8gb? opt:="" md:z:29a6="" nm:i:1="" is="" the="" isize="" the="" insert="" size?="" the="" difference="" between="" pos="" and="" mpos="" is="" 145bp,="" which="" is="" 36bp="" shorter="" than="" isize="" (181).="" my="" question="" is:="" if="" isize="" does="" mean="" insert="" size,="" how="" should="" i="" convert="" insize="" into="" mean="" inner="" distance="" between="" mate="" pairs?="" thanks,="" jianguang="" du<="" div="">
alignment bowtie • 2.6k views
ADD COMMENT • link • modified 6.3 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.3 years ago by Du, Jianguang • 380
0
gravatar for Jennifer Hillman Jackson
6.3 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello Jianguang, On the Bowtie tool form itself, please find this text: Outputs The output is in SAM format, and has the following columns: Column Description 1 QNAME Query (pair) NAME 2 FLAG bitwise FLAG 3 RNAME Reference sequence NAME 4 POS 1-based leftmost POSition/coordinate of clipped sequence 5 MAPQ MAPping Quality (Phred-scaled) 6 CIGAR extended CIGAR string 7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME) 8 MPOS 1-based Mate POSition 9 ISIZE Inferred insert SIZE 10 SEQ query SEQuence on the same strand as the reference 11 QUAL query QUALity (ASCII-33 gives the Phred base quality) 12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE The value of ISIZE is the total insert size for this read pair. Hopefully this helps! Jen Galaxy team -- Jennifer Jackson http://galaxyproject.org
ADD COMMENT • link written 6.3 years ago by Jennifer Hillman Jackson ♦ 25k
Howdy Jianguang, There's a more complete description of the SAM format in "The Sequence Alignment/Map format and SAMtools", Li et al, Bioinformatics (2009). And you can find the latest specification for the format at samtools.sourceforge.net . In the spec, the terminology for the ISIZE field has been changed to TLEN, template length, to allow for sequencing technologies that produce more than two sequenced segments. The description there is "the number of bases from the leftmost mapped base to the rightmost mapped base". So I think to convert to "inner distance between mate pairs" you would typically take ISIZE and subtract the lengths of the mates. Note that for some technologies that value could be negative (which just means the mates overlap). You might need to take into account whether the mates have been mapped with proper orientation-- for example, if an inversion has flipped one mate it has also carried that mate closer to or farther from the other. Bob H
ADD REPLY • link written 6.3 years ago by Bob Harris • 190
I am developing several tools that will need to read and write multiple data files at once. For example, Eisen Cluster produces a heatmap which consists of three files: a .cdt file, .atr file and a gtr file which are the underlying heatmap and the array tree and the gene tree. All three files need to be kept together. I guess I could wrap them in a zip file and pack and unpack them. The heatmap is not just a view only object. Some tools, such as cuttree, would extract one tree and then aggregate genes (or arrays) below a certain depth and create a new trio of files. Is there support for (or plans for creating) any aggregate data types? Thanks Ted CBSE, UCSC
ADD REPLY • link written 6.3 years ago by Ted Goldstein • 40
Hi Ted, There is support for composite datatypes, so this should be possible. http://wiki.g2.bx.psu.edu/Admin/Datatypes/Composite%20Datatypes This kind of discussion is normally directed to the galaxy-dev list (CC'd) Peter
ADD REPLY • link written 6.3 years ago by Peter Cock • 1.4k
Hi All, Thank you for your help. I understand how to do now. Jianguang ________________________________________ To: galaxy-user@lists.bx.psu.edu Cc: Du, Jianguang Subject: Re: [galaxy-user] run Bowtie to estimate Mean Inner Distance between Mate Pairs Howdy Jianguang, There's a more complete description of the SAM format in "The Sequence Alignment/Map format and SAMtools", Li et al, Bioinformatics (2009). And you can find the latest specification for the format at samtools.sourceforge.net . In the spec, the terminology for the ISIZE field has been changed to TLEN, template length, to allow for sequencing technologies that produce more than two sequenced segments. The description there is "the number of bases from the leftmost mapped base to the rightmost mapped base". So I think to convert to "inner distance between mate pairs" you would typically take ISIZE and subtract the lengths of the mates. Note that for some technologies that value could be negative (which just means the mates overlap). You might need to take into account whether the mates have been mapped with proper orientation-- for example, if an inversion has flipped one mate it has also carried that mate closer to or farther from the other. Bob H
ADD REPLY • link written 6.3 years ago by Du, Jianguang • 380
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 172 users visited in the last hour