--fr versus --rf option in Hisat2

Question: --fr versus --rf option in Hisat2

8 months ago by

j.m.fustin • 10 wrote:

Hi!

We have a library of paired reads generated by the UTF-8'en-us'SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian User Manual_063017 from Takara. Read1 is the antisense strand and Read2 is the sense. I wish to use Hisat2 for alignment but I am confused by two options:

1) Specify strand information (unstranded, forward or reverse) 2) Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand --fr --rf -ff

How do these 2 options relate to each other? For our library, should I select --fr or --rf? If I select --fr, should I select forward in option 1? If I select instead --rf, should I then select option 1 to reverse?

Our reads look like this: @K00339:103:HTKCFBBXX:2:1101:5436:1595 1:N:0:CTGAAGCT+GTCAGTAC AGTCGCGCTTCTTTTCCTTACTGTCTTCTTTGACAGTTTCCAGGATAAGTTTGGCCACCGAGTCATTCTTGATGTCTCTATAGTCTGTTACTGAGTCCCA + AAAF-JAFAJFFFJJJJJFJAFF-FFJJFJF<jjjjjfjjjffjjjjjjjfj<ffjfjjjjja7fjafj-<jfjfjjjjjjjjjjjjjfjj<j<-ajfjf @k00339:103:htkcfbbxx:2:1101:5984:1595="" 1:n:0:ctgaagct+gtcagtac="" gagccaccttccccaccgggccttcccggccgtcccggagccggtcgcggcgcaccgccacggtggaagtgcgcccggcggcggccggtcgccggccggg="" +="" aa-fffjf-7fjjjjjjjffjjaf<jjf7fjfjjjjfjjjfjajjjjjjjjjjjjjjjjjjjjajf7jjajjjjjfjjjjjjjjjjjjjjjjfjjajffj="" @k00339:103:htkcfbbxx:2:1101:6614:1595="" 1:n:0:ctgaagct+gtcagtac="" atctggcttcctcggccccgggattcggcgaaagctgcggccggagggctgtaacactcggggtgaggtggttcggcgcgccctgagacgcgccgccccc="" +="" aaff<-affjjff<<jf7jj<a<f7ajfjjjfjjjjjjjf<fjafj<jjajfjffjjfjjjja7-<a-f<ff<j7fj<7ajjjjff<<-7a<ajajj<-a="" @k00339:103:htkcfbbxx:2:1101:7060:1595="" 1:n:0:ctgaagct+gtcagtac="" tggtccagaggcgcgtgtcttcctgaggctctaccagaaactgctcccgagctgtttgcaagactagttccacagaatcagtatagctaaactgaatggt="" +="" aaaffjjjjjjjjjjfjfjjfjjfjjfjjjjjjjjjjjjjjjjjfjjfjj<jjj<jjjjjfjjffjjffjjjjjjjjjjjjafjjjjjjjjjjjjjjjff="" @k00339:103:htkcfbbxx:2:1101:7527:1595="" 1:n:0:ctgaagct+gtcagtac="" gggtgcccatagaggttacaaggggccattggatccttttgacctggagttgaggaatgttagttttcaatagctgagtagtattccattgtagaaatga<="" p="">

THank you for your always excellent help!

rna-seq • 448 views

ADD COMMENT • link •

modified 8 months ago • written 8 months ago by j.m.fustin • 10

8 months ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hello,

See the graphic here to understand your data content: http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/Next_Gen_Sequencing_Kits/Total_RNA-Seq/xxclt_displayImage.jsp?imgCntId=136227&sitex=10020:22372:US

Your data is forward and -rf. Enter reads1 first and reads2 second on the tool form. Or if you have multiple samples, create a paired-end dataset collection with that structure.

Galaxy tutorials: https://galaxyproject.org/learn/

Thanks! Jen, Galaxy team

ADD COMMENT • link written 8 months ago by Jennifer Hillman Jackson ♦ 25k

8 months ago by

j.m.fustin • 10

j.m.fustin • 10 wrote:

Hi Jen,

Thanks a lot for your always useful comments. I thought it was so, but then I ran into a different problem. I first aligned with the option forward --fr, and got "70% reads aligned concordantly exactly 1 time". It seemed OK. Then, noticing my mistake with the library type, ran the same fastqsanger input files with option forward --rf and got about 98% "aligned concordantly 0 times". I still cannot explain what happened. Any idea? Both times I did input first read1 then read2 on the tool form.

It does no seem to be a QA problem because it ran OK the first time (but with the wrong option selected).

ADD COMMENT • link written 8 months ago by j.m.fustin • 10

Please log in to add an answer.

Similar posts • Search »