Question: Research on RNA SEQ
0
gravatar for a.morris
6 days ago by
a.morris10
a.morris10 wrote:

Dear Advisor

You were very helpful with overcoming my Galaxy problems at the end of last year and Im hoping you are still in a position to help again. I am testing two downloaded files (paired end) for SRX1725724 via ENA.

(Error 1) When I try FastQC, the following error msg is returned:

“Fatal error: Exit code 1 () Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/galaxy-repl/main/jobdir/020/014/20014685/_job_tmp -Xmx7g -Xms256m

Failed to process EBI SRA_ SRR3438598 File_ ftp___ftp_sra_ebi_ac_uk_vol1_fastq_SRR343_008_SRR3438598_SRR3438598_1_fastq_gz

uk.ac.babraham.FastQC.Sequence.SequenceFormatException: ID line didn't start with '@'

      at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:158)

      at uk.ac.babraham.FastQC.Sequence.FastQFile.<init>(FastQFile.java:89)

      at uk.ac.babraham.FastQC.Sequence.SequenceFactory.getSequenceFile(SequenceFactory.java:87)

      at uk.ac.babraham.FastQC.Sequence.SequenceFactory.getSequenceFile(SequenceFactory.java:62)

      at uk.ac.babraham.FastQC.Analysis.OfflineRunner.processFile(OfflineRunner.java:152)

      at uk.ac.babraham.FastQC.Analysis.OfflineRunner.<init>(OfflineRunner.java:121)

      at uk.ac.babraham.FastQC.FastQCApplication.main(FastQCApplication.java:316)

(Error 2) When I tried FastQJoiner I get another error msg:joiner", line 6, in <module>

sys.exit(galaxy_utils.sequence.scripts.fastq_paired_end_joiner.main())

File "/cvmfs/main.galaxyproject.org/deps/_conda/envs/__galaxy_sequence_utils@1.1.2/lib/python2.7/site-packages/galaxy_utils/sequence/scripts/fastq_paired_end_joiner.py", line 146, in main for i, fastq_read in enumerate(fq.fastqReader(path=input1_filename, format=input1_type)): File "/cvmfs/main.galaxyproject.org/deps/_conda/envs/__galaxy_sequence_utils@1.1.2/lib/python2.7/site-packages/galaxy_utils/sequence/fastq.py", line 616, in __iter__ yield next(self) File "/cvmfs/main.galaxyproject.org/deps/_conda/envs/__galaxy_sequence_utils@1.1.2/lib/python2.7/site-packages/six.py", line 564, in next return type(self).__next__(self) File "/cvmfs/main.galaxyproject.org/deps/_conda/envs/__galaxy_sequence_utils@1.1.2/lib/python2.7/site-packages/galaxy_utils/sequence/fastq.py", line 592, in __next__ assert fastq_header.startswith('@'), 'Invalid fastq header: %s' % fastq_header AssertionError: Invalid fastq header: ­�

The problems that an inexpert eye like mine can see are that for (1) the id lines don’t start with @ and (2) an invalid header and/or the ‘@’ problem.

Here are the first few lines of one of the data files (All id lines here appear to start with@, so I don’t understand?)

@SRR3438598.1 1/1 GTAGTGGTAGGTATCCTGGGGNNCCCGGGTGAAGAACCTGTCCTGGAAGA + ;;:@><<>9:;##2<89@?391?<=???>?>????<99=; @SRR3438598.2 2/1 CAGACGGGGTGTGGGTGGGCGNTGCCGCAAGAAGAGGGGAGGGTGGAGCT + B@@DFFFFHFDDFGIEHIJJJ#08DFGEIIIEDHCHEBDDDDD,=@BBDB @SRR3438598.3 3/1 GTGTCCTTGTCGCTGTTGNACNNGTAGGCATAGGGGCGCCGCACCACCAC + <<<@@?@@@@@?@@?@@?#3@##2<@@???????????????<====<###4##21@=??????????????????????< @SRR3438598.9 9/1 GTCCCTATGGTATGGAACNCANNCTGCCCTCCCCGGCCCTCCTCACTCCT + <<<@@?@@@@@@@@@?@@#3=##2<>@??????????????????????? @SRR3438598.10 10/1 GGAGGGTNNNATAGAGANNNANNANAATTGTAATAAGCAGTGCTTGAATT +

Your help would be much appreciated

Thanks

Alex

software error • 29 views
ADD COMMENTlink written 6 days ago by a.morris10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 151 users visited in the last hour