Advanced Text Manipulations In Galaxy

Question: Advanced Text Manipulations In Galaxy

8.0 years ago by

Hello, Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like: "Substitute all Gs to Cs (except for CG dinucleotides)": Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT or like: "Count the number of CG dinucleotides" Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4 using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills? Thank you in advance! With respect, Maxim Ivanov Dept. of Physiology and Pharmacology Karolinska Institutet Stockholm, Sweden

galaxy • 523 views

ADD COMMENT • link •

modified 7.9 years ago by Jennifer Hillman Jackson ♦ 25k • written 8.0 years ago by Maxim Ivanov • 10

7.9 years ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hello Maxim, Using the tools in EMBOSS can help with these type of text manipulations if you find the basic Text Manipulations tools do not do exactly what you want. For #1, use EMBOSS->biosed to perform substitutions. For #2, use EMBOSS->fuzznuc. A workflow for #2, using your data, is here as an example: http://main.g2.bx.psu.edu/u/jen-bx-galaxy-edu/h/wf-advanced-text- manipulations-in-galaxy No stupid questions! Very glad we could help you to get going. Apologies for the late reply. Best, Jen Galaxy team -- Jennifer Jackson http://usegalaxy.org

ADD COMMENT • link written 7.9 years ago by Jennifer Hillman Jackson ♦ 25k

Similar posts • Search »