Question: bwa mem index builder error
0
gravatar for Stef van Lieshout
3.4 years ago by
Netherlands
Stef van Lieshout • 10 wrote:

I would like to use the BWA mapper tool so I installed the tool "bwa" from "devteam" from main toolshed in our local galaxy: https://toolshed.g2.bx.psu.edu/view/devteam/bwa/ac30bfd3e2a8

To get the genome index I installed "data_manager_bwa_mem_index_builder": https://toolshed.g2.bx.psu.edu/view/devteam/data_manager_bwa_mem_index_builder/6da5d738041d

When trying to run the data manager on any fasta genome (via "Manage local data (beta)", "Run Data Manager Tools", "BWA-MEM index - builder") the job immediately stops in error state. But it doesn't show any error (the stderr and stdout are empty) so I'm kind of in the dark what went wrong.

How can I find out what the problem is? I do have ssh access to the galaxy server btw.

Many thanks,
Stef

 

The command involved as shown in "View Data Manager Jobs":

python /mnt/data/galaxy-home/tst-ctmm-gal/shed_tools/toolshed.g2.bx.psu.edu/repos/devteam/data_manager_bwa_mem_index_builder/6da5d738041d/data_manager_bwa_mem_index_builder/data_manager/bwa_mem_index_builder.py "/opt/galaxy/galaxy-dist/database/files/001/dataset_1094.dat" --fasta_filename "/mnt/galaxyIndices/genomes/phiX174/phix/seq/phix.fa" --fasta_dbkey "phix" --fasta_description "phiX174" --data_table_name "bwa_mem_indexes"

 

bwa-mem bwa builder index • 1.3k views
ADD COMMENT • link • modified 3.3 years ago • written 3.4 years ago by Stef van Lieshout • 10
0
gravatar for Daniel Blankenberg
3.4 years ago by
Daniel Blankenberg ♦♦ 1.7k
United States
Daniel Blankenberg ♦♦ 1.7k wrote:

As the admin user, can you go into the analysis interface, click on saved histories --> switch to the 'Data Manager History (automatically created)', then click the 'bug' link for the failed dataset and see if there is any info there?

 

Thanks for using Galaxy,

Dan

ADD COMMENT • link written 3.4 years ago by Daniel Blankenberg ♦♦ 1.7k
0
gravatar for Stef van Lieshout
3.4 years ago by
Netherlands
Stef van Lieshout • 10 wrote:

Ok, yes there is info there, although I dont know what is meant with the "dictionary update sequence" mentioned?

Traceback (most recent call last):
  File "/mnt/data/galaxy-home/tst-ctmm-gal/galaxy-dist/lib/galaxy/jobs/runners/lwr.py", line 378, in finish_job
    remote_working_directory=remote_working_directory
  File "/mnt/data/galaxy-home/tst-ctmm-gal/galaxy-dist/lib/galaxy/jobs/__init__.py", line 1207, in finish
    self.tool.exec_after_process( self.queue.app, inp_data, out_data, param_dict, job=job )
  File "/mnt/data/galaxy-home/tst-ctmm-gal/galaxy-dist/lib/galaxy/tools/__init__.py", line 3340, in exec_after_process
    data_manager.process_result( out_data )
  File "/mnt/data/galaxy-home/tst-ctmm-gal/galaxy-dist/lib/galaxy/tools/data_manager/manager.py", line 267, in process_result
    data_manager_dict[ key ].update( value )
ValueError: dictionary update sequence element #0 has length 6; 2 is required

The original test-fasta (had same issue with hg19) looks like this:

head  /mnt/galaxyIndices/genomes/phiX174/phix/seq/phix.fa
>NC_001422.1
GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
ADD COMMENT • link modified 3.4 years ago • written 3.4 years ago by Stef van Lieshout • 10
0
gravatar for Stef van Lieshout
3.4 years ago by
Netherlands
Stef van Lieshout • 10 wrote:

Maybe it has to do with the following trello card: https://trello.com/c/MZGPlWuk/2098-pull-request-510-fix-for-data-manager-failure-to-update-a-dict-when-a-list-is-passed-instead-of-a-dict

It has the exact same ValueError named and you archived it Dan, saying "PR was declined, as error wasn't due to issue in framework, but was result of the underlying rnastar binary not running correctly while the Galaxy tool wrapper also wasn't setting job run to error."

What was the problem there?

ADD COMMENT • link written 3.4 years ago by Stef van Lieshout • 10
0
gravatar for y.hoogstrate
3.4 years ago by
y.hoogstrate • 460
Netherlands
y.hoogstrate • 460 wrote:

I am working on the same machine and I saw that the json string contains:

"output_data": [{
            "extra_files_path": "/opt/galaxy/galaxy-dist/database/job_working_directory/000/716/dataset_1094_files",
            "ext": "data_manager_json",
            "out_data_name": "out_file",
            "hda_id": 1080,
            "file_name": "/opt/galaxy/galaxy-dist/database/files/001/dataset_1094.dat",
            "dataset_id": 1094}
            ],

I hope this helps.

ADD COMMENT • link written 3.4 years ago by y.hoogstrate • 460
0
gravatar for Stef van Lieshout
3.4 years ago by
Netherlands
Stef van Lieshout • 10 wrote:

Nobody an idea what goes wrong here? Dan, do you remember what the problem mentioned in the trello card was?

ADD COMMENT • link written 3.4 years ago by Stef van Lieshout • 10
0
gravatar for Stef van Lieshout
3.3 years ago by
Netherlands
Stef van Lieshout • 10 wrote:

I see now I get the exact same error with the SNPeff data manager....

ValueError: dictionary update sequence element #0 has length 6; 2 is required
ADD COMMENT • link written 3.3 years ago by Stef van Lieshout • 10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 182 users visited in the last hour