I'm trying to modify a tool so that a user can type in data and pipe it from stdin (e.g. <echo "ACGTATGATGT") instead of providing it to galaxy as a fasta file. The command is included below. When I try to execute this command in galaxy I get a syntax error. However, when I view the "job command-line" and execute that outside of galaxy it functions correctly. Can anyone tell me what the problem is?
<command>
blastn
-query <(echo -e "$input_seq.query2")
</command>
Fatal error: Exit code 2 ()
/nfs/seqdata/galaxy-data/job_working_directory/000/118/galaxy_118.sh: line 17: syntax error near unexpected token `('
/nfs/seqdata/galaxy-data/job_working_directory/000/118/galaxy_118.sh: line 17: `PACKAGE_BASE=/opt/shed_tools/blast+/2.2.29/devteam/ncbi_blast_plus/623f727cdff1; export PACKAGE_BASE; . /opt/shed_tools/blast+/2.2.29/devteam/ncbi_blast_plus/623f727cdff1/env.sh; blastn -version > /nfs/seqdata/galaxy-data/tmp/GALAXY_VERSION_STRING_118 2>&1; bash /opt/shed_tools/toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/623f727cdff1/ncbi_blast_plus/tools/ncbi_blast_plus/blastn -query <(echo -e "CTTCGAACCTCTGCCATCAGGACAGCCCCCAATCCCTATTATTGCCAGGTGGGGCTTGGCCCGGCCCAGTCCTGGCCTCTGCCACCAGGTGTCACCGAGGTTTCCCCAGCCAATGTTACTCTGCTCAGAG") -db "/nfs/seqdata/blastdb/nt_nr" -task blastn -evalue 0.001 -out "/nfs/seqdata/galaxy-data/files/000/dataset_350.dat" -outfmt "6 std sallseqid score nident positive gaps ppos qframe sframe qseq sseq qlen slen salltitles" -num_threads "${GALAXY_SLOTS:-8}"'
