Question: Error message after running FreeBayes
0
gravatar for federico.bernuzzi
8 months ago by
Quadram Institute of BioSciences
federico.bernuzzi20 wrote:

Hi,

I am quite new with Galaxy only been working with it for a month so please bare with me. I am trying to identify SNP variants from RNA-Seq data of prostate cancer tissue. All of the previous steps in the pipeline have successfully worked (FastQC, TrimGalore, FASTQC and HISAT2). When i launch FreeBayes on the results obtained from HISAT2 I get the following error. I was wondering whether someone has come across this error message before and could point me towards the right direction on what is causing the issue.

Fatal error: Exit code 3 () Exception: Unable to read reference sequence base past end of current cached sequence. KI270304.1:1047 1046-2166 alignment: GTTTCTGAGAATCGTTCTGTCTAGTTTCTATAGGAAGATATTTCCTATTCTACCATTGACCTCAAAGCGGCTGAAATCTCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCAAATTCGACAAAAA currentSequence: TCTGTGAGTTGAACGAACACATCACAACGCAGTTTGAGGGAATGATTCTGTCTAGTTTTGAAACGAAGATATTTCCTTTTCTGCCATTGACATAAACGCTTGAAATCTACAGTTGCCAATTGCACAAATAGAGTGTTTCAAATCTGCTCTGTCTAAGGGAACGTTCAACTCTGTGAGTTGAATGCACACAACACAAGGAAGTTACTGGGAATTCTTCTGTCTAGCCTGACAGGAAAAAAACCCTTTTCCAACGAAGGCCTCTAAGTGGTCCAATTATCCACGTGCAGAGTTTACAAACAGAGTGTTTCAAACTGCTGAATGAAAAGAAAAGTTAAACTCTGAGAGTTGAACGCACACATCACAGAGCAGTTTCTGAGAATGATTCTGTCTAGTTTTTATACGACGATATTTACTTTTCTGCTTTTGGCCCCAAAGCGCTTGAAATCTCCACTTGCAAATCCAAAAAAACAGTGTTTCAAATCTGCTCTCTCTAAATGAAAGTTCAACTCTGTCAGTTGAATACACACAACACAAGGAAGTTACTGAGAATTCTTCTGTCTAGCCTTAAATGAAAAAAACCCGTTTCCAACGAAGGCCTCAAAGAAGTCCAAATATCCACGTGCAGACATTACAAACAGAGTGTTTCCTAACTGCTCTATGAAAAAAAGGTTAAACTCTGTGAGTTGAATGCCCACAGCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTTTATACGAAGATATTTCCTTTTCTACCATTGATCTCAAAGCGGCTGAAATCTCCACTTGCAAATTCCACAAAAAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTTCAACTCTGTGAGTTGAACACACACAAAACAAGGAAGTTACTGAGAATTCTTCTGTCTAGCAGAATATGAAGAAATCCCGTTTCCAACGAAGGCCTCAAAGAGGTCTGAATATCCACTTGCAGACTTTTCAGAAAGAGTGTTTCCTAACTGCTCTATGAAAAGAAAGGTTAAACTCTGTGAGTTGAACGCACACATCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTCTATAGGAAGATATTTCCTATTCAACCATTGACCTCAAAGCGGCTGAAATCTCCACCTGCAAATTCCATAAAAAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTACAACTCTGTGAGTTGAATACACACAACAAAAAGAAGTTACTGAGAATTCTTCTGTCTAGCAGAATATGAAGAAATCCCGCTTCCAACGAATGCCTCAAAGAGGTCTGAATATCCACTTGCAGACTTTTCAGAAAGAGTGTTTCCTAACTGCTCTATGAAAAGAAAGGTTAAACTCTGTGAGTTGAACGCACACATCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTTTATACGAAGATATTTCCTTTTCTATCATTGACCTCAAAGCGGCTGAAATCTCCACTTGCAAATTCCACAAATAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTTCAACTCTGTGAGTTGAATACACACAACACAAGGAAGTTACTGAGAATTCTTCTGTGTAGCAGAAGATGAAGAAATCCCGTTTCCAACGAAGGCCACAAGATGTCAGAATATCCACTTACAGACTTTACAAACAGAGTGTTTCCTAACTGCTCTATGAACAGAAAGGTTAAACTCTGTGAGCTGAACGAACACATCACAACGCAGTTTGTGGGAATGATTCTGTCTAGTTTTGAAACGAAGATATTTCCTTTTCTGCCATTGACCTTAAAGCGCTTGAAATCTACACTTGCAAATTGCACAAATACAGTGTTTCAAATCTGCTCTGTCTAAGGGAACGTTCAACTCTGTGAGTTGAATGCACACAACACAAGGAAGTTACTGGGAATTCTTCTGTTTAGCCTTACATGAAAAAAACCCGTTTCCAACGAAGGCCTCTAAGTGGTCAAAATATCCACGTGCAGACTTTACAAACAGAGTGTTTCCAAACCGCTGAATGAAAAGAAAAGTAAAACTCTGAGAGGTAATCCCACACATCACGCAGCAGTTTCTGAGAATGATTCTGTCCAGTTTTTATACCAAGATATTTCCTTTTCTGCCTTTGTCCCCAAAGCGCTTGAAATCTCCACTTGCAAATTCCACAAAA currentSequence matching: Exception: Unable to read reference sequence base past end of current cached sequence. KI270304.1:1053 1052-2171 alignment: GAGAATCATTCTGTCTAGTTTCTATAGGAAGATATTTCCTATTCTACCATTGACCTCAAAGCGGCTGAAATCTCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCAAATTCCACAAAAAGAGTG currentSequence: TCTGTGAGTTGAACGAACACATCACAACGCAGTTTGAGGGAATGATTCTGTCTAGTTTTGAAACGAAGATATTTCCTTTTCTGCCATTGACATAAACGCTTGAAATCTACAGTTGCCAATTGCACAAATAGAGTGTTTCAAATCTGCTCTGTCTAAGGGAACGTTCAACTCTGTGAGTTGAATGCACACAACACAAGGAAGTTACTGGGAATTCTTCTGTCTAGCCTGACAGGAAAAAAACCCTTTTCCAACGAAGGCCTCTAAGTGGTCCAATTATCCACGTGCAGAGTTTACAAACAGAGTGTTTCAAACTGCTGAATGAAAAGAAAAGTTAAACTCTGAGAGTTGAACGCACACATCACAGAGCAGTTTCTGAGAATGATTCTGTCTAGTTTTTATACGACGATATTTACTTTTCTGCTTTTGGCCCCAAAGCGCTTGAAATCTCCACTTGCAAATCCAAAAAAACAGTGTTTCAAATCTGCTCTCTCTAAATGAAAGTTCAACTCTGTCAGTTGAATACACACAACACAAGGAAGTTACTGAGAATTCTTCTGTCTAGCCTTAAATGAAAAAAACCCGTTTCCAACGAAGGCCTCAAAGAAGTCCAAATATCCACGTGCAGACATTACAAACAGAGTGTTTCCTAACTGCTCTATGAAAAAAAGGTTAAACTCTGTGAGTTGAATGCCCACAGCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTTTATACGAAGATATTTCCTTTTCTACCATTGATCTCAAAGCGGCTGAAATCTCCACTTGCAAATTCCACAAAAAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTTCAACTCTGTGAGTTGAACACACACAAAACAAGGAAGTTACTGAGAATTCTTCTGTCTAGCAGAATATGAAGAAATCCCGTTTCCAACGAAGGCCTCAAAGAGGTCTGAATATCCACTTGCAGACTTTTCAGAAAGAGTGTTTCCTAACTGCTCTATGAAAAGAAAGGTTAAACTCTGTGAGTTGAACGCACACATCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTCTATAGGAAGATATTTCCTATTCAACCATTGACCTCAAAGCGGCTGAAATCTCCACCTGCAAATTCCATAAAAAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTACAACTCTGTGAGTTGAATACACACAACAAAAAGAAGTTACTGAGAATTCTTCTGTCTAGCAGAATATGAAGAAATCCCGCTTCCAACGAATGCCTCAAAGAGGTCTGAATATCCACTTGCAGACTTTTCAGAAAGAGTGTTTCCTAACTGCTCTATGAAAAGAAAGGTTAAACTCTGTGAGTTGAACGCACACATCACAAAGGAGTTTCTGAGAATCATTCTGTCTAGTTTTTATACGAAGATATTTCCTTTTCTATCATTGACCTCAAAGCGGCTGAAATCTCCACTTGCAAATTCCACAAATAGAGTGTTTCAAGTCTGCTCTGTGTAAAGGATCGTTCAACTCTGTGAGTTGAATACACACAACACAAGGAAGTTACTGAGAATTCTTCTGTGTAGCAGAAGATGAAGAAATCCCGTTTCCAACGAAGGCCACAAGATGTCAGAATATCCACTTACAGACTTTACAAACAGAGTGTTTCCTAACTGCTCTATGAACAGAAAGGTTAAACTCTGTGAGCTGAACGAACACATCACAACGCAGTTTGTGGGAATGATTCTGTCTAGTTTTGAAACGAAGATATTTCCTTTTCTGCCATTGACCTTAAAGCGCTTGAAATCTACACTTGCAAATTGCACAAATACAGTGTTTCAAATCTGCTCTGTCTAAGGGAACGTTCAACTCTGTGAGTTGAATGCACACAACACAAGGAAGTTACTGGGAATTCTTCTGTTTAGCCTTACATGAAAAAAACCCGTTTCCAACGAAGGCCTCTAAGTGGTCAAAATATCCACGTGCAGACTTTACAAACAGAGTGTTTCCAAACCGCTGAATGAAAAGAAAAGTAAAACTCTGAGAGGTAATCCCACACATCACGCAGCAGTTTCTGAGAATGATTCTGTCCAGTTTTTATACCAAGATATTTCCTTTTCTGCCTTTGTCCCCAAAGCGCTTGAAATCTCCACTTGCAAATTCCACAAAA currentSequence matching:

Many thanks for the help and support.

Federico B

ADD COMMENTlink modified 8 months ago by Anton Nekrutenko1.7k • written 8 months ago by federico.bernuzzi20
0
gravatar for Jennifer Hillman Jackson
8 months ago by
United States
Jennifer Hillman Jackson23k wrote:

Hello,

Formatting might be the source of the problem. Places to look for problems: the original fastq data (not really in fastqsanger format), the custom genome fasta format needs to be modified (if one is being used), other inputs need to be sorted (BAM) or are missing data (header incomplete on SAM), etc.

The Troubleshooting section of the Galaxy support wiki has how-to help for resolving errors.

A google search with the error message brings up many similar reported issues at the Freebayes Github site and it looks like input format is almost always the root issues when this message results (line-command usage, but remember that Galaxy is just that same tool wrapped). You could also review those. If after checking you cannot determine the root problem, a bug report can be sent in (how-to is also described on the support page above, at the link "Issues").

That said, there was a bug in an earlier version of the software. The authors explains it here. You are not the only one to run into this issue. https://github.com/ekg/freebayes/issues/6

Thanks, Jen, Galaxy team

ADD COMMENTlink modified 8 months ago • written 8 months ago by Jennifer Hillman Jackson23k
0
gravatar for federico.bernuzzi
8 months ago by
Quadram Institute of BioSciences
federico.bernuzzi20 wrote:

Hi Jen,

Many thanks for the advice and help Kind regards

FB

ADD COMMENTlink written 8 months ago by federico.bernuzzi20
0
gravatar for Anton Nekrutenko
8 months ago by
Penn State
Anton Nekrutenko1.7k wrote:

Federico B:

HISAT is a spliced mapper and it is possible that FreeBayes does not like BAM files generated by HISAT. Can you try Naive Varinat Caller instead and see if you will be getting valid VCF.

ADD COMMENTlink written 8 months ago by Anton Nekrutenko1.7k

Hi Anton,

You raised a very good point. I thought that maybe HISAT2 might cause the problem and was thinking of running TopHat and then putting the results (the accepted hits file) into FreeBayes to see whether that would work. I have not come across Naive Variant Caller so I am not exactly sure how it works.

Many thanks for the help and advice. Much appreciated

Best wishes

FB

ADD REPLYlink written 8 months ago by federico.bernuzzi20

Naive Variant Caller is ... naive. It just tabulates the number of differences. But since calling variants in RNAseq does not necessary follow diplod assumption it may work for you (FreeBayes also has pooled continuous function for such cases). It is the NGS: Variant Analysis section on the tool panel,

ADD REPLYlink written 8 months ago by Anton Nekrutenko1.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 120 users visited in the last hour