Question: Problems converting a file to FASTA
0
gravatar for srodriguezmar
3.1 years ago by
Israel
srodriguezmar • 0 wrote:

Hello! How are you?

I am having a hard time converting a file. I have  FASTA formatted sequences from a Roche (454) FLX sequencing run. They look like this:

>an-52_GO0Z3GB03HJJ8X    bdiffs=0(match) fpdiffs=0(match)      rank=0000442 x=2976.5 y=431.0 length=430
CCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA

I used the Fasta-to-Tabular converter. I had a 3 column output:

Column 1: an-52_GO0Z3GB03HJJ8X 

Column 2: bdiffs=0(match) fpdiffs=0(match)      rank=0000442 x=2976.5 y=431.0 length=430

Column 3: CCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA

Then I used the Tabular-to-Fasta converter. I selected the first column as title (an-52_GO0Z3GB03HJJ8X) and the 3rd as sequence.

The problem is that the fasta file that I got after doing all these conversions has all the columns in a line. When I open it in notepad, it looks like this:

>an-52_GO0Z3GB03HJJ8XCCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA>an-52_GO0Z3GB03HHY99CTCCCGTAGGAGTCTGGGCCGTATCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTACCGATCGTCGGCTTGGTGAGCCATTACCTCACCAACTACCTAATCGGACGCGGGCTCCTCTTCTGGCGATAAATCTTTCCCTCGCGGGTGCATCCGGTATTAGCCGCAGTTTCCCGCGGTTATCCCGAACCAAAAGGCAGATTCCCACGTG

When I want to use this file on mothur, the program tells me that the fasta file is empty. Do you know what can I do to be able to use this fasta in mothur? Did I do something wrong in the file conversions?

Thank you!!!!!

 

 

fasta convert galaxy • 807 views
ADD COMMENT • link • modified 3.1 years ago • written 3.1 years ago by srodriguezmar • 0
2
gravatar for Wolfgang Maier
3.1 years ago by
Germany
Wolfgang Maier • 600 wrote:

Do not believe what notepad shows you.

Notepad is a really, really basic editor that cannot handle UNIX-style newlines ('\n'),  but only Windows ones ('\r\n').

What does the content look like in Galaxy? Try to open your file with any other editor and most likely the file's content will look just fine.

That said, I have no idea why you run into the problem with mothur (which I've never used).

ADD COMMENT • link written 3.1 years ago by Wolfgang Maier • 600
0
gravatar for srodriguezmar
3.1 years ago by
Israel
srodriguezmar • 0 wrote:

Thank you! I will check it out!

 

ADD COMMENT • link written 3.1 years ago by srodriguezmar • 0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 169 users visited in the last hour