Error in CuffDiff

>hsa-let-7a-1 MI0000060 TGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA >hsa-let-7a-2 MI0000061 AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCT >hsa-let-7a-3 MI0000062 GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTGCTATGGGATAACTATACAATCTACTGTCTTTCCT

3.4 years ago by

Jennifer Hillman Jackson ♦ 25k

United States

Jennifer Hillman Jackson ♦ 25k wrote:

Hello,

Cuffdiff requires a specific set of GTF/GFF3 attributes in order to generate the full compliment of statistics. iGenomes is the best source, if available for your reference genome/build. Reference annotation data can be obtained here: http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/index.html#cuffdiff-input-files

Best, Jen, Galaxy team

ADD COMMENT • link written 3.4 years ago by Jennifer Hillman Jackson ♦ 25k

Jen,

This will not help me as fasta files and gff files for micro RNA are not available through igenomes. Other people are using CuffDiff for miRNA analysis so there must be another way. Thanks for your help.

ADD REPLY • link written 3.4 years ago by gkuffel22 • 170

Hi, I am new in Galaxy. I would like to analyze miRNA-Seq data but I realized the same problem: cuffdiff didn't work. I would be interest if you could solve this problem. Thanks for your reply

ADD REPLY • link written 16 months ago by valasek • 0

Hello, Cuffidff utilizes the information provided in the given GTF to combine and annotate results.

Certain attributes must be present in the GTF/GFF3 data for Cuffdiff to generate the full complement of statistics. Specifically, tss_id and p_id. Should the value gene_id be also present, gene information will be included in the output. http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/#cuffdiff-input-files
It is important that custom reference genomes do not include "description" content on the title line ">" of the fasta file. The tool NormalizeFasta can be used to remove description content, leaving only the identifier (which is important to be an exact match for the identifiers in the GTF/GFF3 input). https://galaxyproject.org/learn/custom-genomes/ and https://galaxyproject.org/support/chrom-identifiers/
Sorting results prior to tool use is often important. This is how: https://galaxyproject.org/support/sort-your-inputs/
If HISAT is used for mapping, setting the tool form options to produce Cufflinks appropriate output is important. This is how: https://biostar.usegalaxy.org/p/23367/#23369
Galaxy tutorials for RNA-seq analysis. There are other tool options explained in the tutorials. https://galaxyproject.org/learn/
The Galaxy Training Networks hosts many of the above tutorials plus others. Available here: https://galaxyproject.org/teach/gtn/ (overview) and http://galaxyproject.github.io/training-material/ (resources) and please specifically see https://galaxyproject.github.io/training-material//topics/transcriptomics/tutorials/srna/tutorial.html
To understand results such as "NOTEST" (and others), these are covered in the Cufflinks manual here: http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/#differential-expression-tests. If any are unclear, there is a Google group for the tool that may have the answers you seek, and it is linked from that same website.

Hopefully this helps! Jen

ADD REPLY • link modified 16 months ago • written 16 months ago by Jennifer Hillman Jackson ♦ 25k

tracking_id	gene_id	tss_id	locus	length	coverage	FPKM	FPKM_conf_lo	FPKM_conf_hi	FPKM_status
CUFF.1	CUFF.1	-	hsa-let-7a-1:4-80	-	-	1.04E+07	1.03E+07	1.05E+07	OK
CUFF.2	CUFF.2	-	hsa-let-7a-2:3-70	-	-	1.50E+07	1.48E+07	1.52E+07	OK
CUFF.3	CUFF.3	-	hsa-let-7a-3:2-74	-	-	1.22E+07	1.21E+07	1.24E+07	OK

gene_id	locus	sample_1	sample_2	status	value_1	value_2	log2(fold_change)	test_stat	p_value	q_value	significant
XLOC_000001	chr1:30365-30503	Control	Treatment	NOTEST	0	0	0	0	1	1	no
XLOC_000002	chr1:1167103-1167198	Control	Treatment	NOTEST	0.00E+00	0.00E+00	0	0	1	1	no
XLOC_000003	chr1:1167862-1167952	Control	Treatment	NOTEST	0.00E+00	0.00E+00	0	0	1	1	no
XLOC_000004	chr1:1169004-1169087	Control	Treatment	NOTEST	0.00E+00	0.00E+00	0	0	1	1	no

chr1	miRNA_primary_transcript	17369	17436	ID=MI0022705;Alias=MI0022705;Name=hsa-mir-6859-1
chr1	miRNA	17409	17431	ID=MIMAT0027618;Alias=MIMAT0027618;Name=hsa-miR-6859-5p;Derives_from=MI0022705
chr1	miRNA	17369	1.74E+04	ID=MIMAT0027619;Alias=MIMAT0027619;Name=hsa-miR-6859-3p;Derives_from=MI0022705

Similar posts • Search »