Hello! How are you?
I am having a hard time converting a file. I have FASTA formatted sequences from a Roche (454) FLX sequencing run. They look like this:
>an-52_GO0Z3GB03HJJ8X bdiffs=0(match) fpdiffs=0(match) rank=0000442 x=2976.5 y=431.0 length=430
CCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA
I used the Fasta-to-Tabular converter. I had a 3 column output:
Column 1: an-52_GO0Z3GB03HJJ8X
Column 2: bdiffs=0(match) fpdiffs=0(match) rank=0000442 x=2976.5 y=431.0 length=430
Column 3: CCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA
Then I used the Tabular-to-Fasta converter. I selected the first column as title (an-52_GO0Z3GB03HJJ8X) and the 3rd as sequence.
The problem is that the fasta file that I got after doing all these conversions has all the columns in a line. When I open it in notepad, it looks like this:
>an-52_GO0Z3GB03HJJ8XCCCGCTTTCTCCCTCAGGACGTATGCGGTATTAGCGTAGCTTTCGCTACGTTATCCCCACGACATGGGCACGTTCCGATGCA>an-52_GO0Z3GB03HHY99CTCCCGTAGGAGTCTGGGCCGTATCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTACCGATCGTCGGCTTGGTGAGCCATTACCTCACCAACTACCTAATCGGACGCGGGCTCCTCTTCTGGCGATAAATCTTTCCCTCGCGGGTGCATCCGGTATTAGCCGCAGTTTCCCGCGGTTATCCCGAACCAAAAGGCAGATTCCCACGTG
When I want to use this file on mothur, the program tells me that the fasta file is empty. Do you know what can I do to be able to use this fasta in mothur? Did I do something wrong in the file conversions?
Thank you!!!!!
