Question: What is the ROD file -Need help with "Realigner Target Creator" tool
3
gravatar for Guy Reeves
3.2 years ago by
Guy Reeves1.0k
Germany
Guy Reeves1.0k wrote:

HI

I am trying to use a vcf file in the Realigner Target Creator tool.  The vcf file reports all variants for a large panel.  However when I use this file I have (a very small part of which is copied below)  get an error after processing.  

To be honest I cannot find any explanations of the  ROD format or what the options ' dbSNP SNPs INDELs Custom '  specify. 

Would be very grateful to any advice.

Thanks

 

Guy

 

 

Binding for reference-ordered datas

Binding Type:

 dbSNP SNPs INDELs Custom 

ROD file:

 

 

##fileformat=VCFv4.1
##INFO=<ID=AC,Number=1,Type=Integer,Description="Allele count">
##INFO=<ID=SD,Number=0,Type=Flag,Description="Segmental duplication">
##INFO=<ID=HP,Number=0,Type=Flag,Description="Homopolymer indel">
##INFO=<ID=MS,Number=0,Type=Flag,Description="Microsatellite indel">
##INFO=<ID=TR,Number=0,Type=Flag,Description="Tandem repeat indel">
##INFO=<ID=IV,Number=0,Type=Flag,Description="Inversion">
##INFO=<ID=IN,Number=0,Type=Flag,Description="Variant in intron">
##INFO=<ID=UT,Number=0,Type=Flag,Description="Variant in UTR">
##INFO=<ID=CD,Number=0,Type=Flag,Description="Variant in protein-coding sequence">
##INFO=<ID=SY,Number=0,Type=Flag,Description="Synonymous SNP">
##INFO=<ID=NS,Number=0,Type=Flag,Description="Non-synonymous SNP">
##INFO=<ID=ST,Number=0,Type=Flag,Description="Stop codon-introducing SNP">
##INFO=<ID=RS,Number=0,Type=Flag,Description="Stop codon-removing SNP">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	DGRP-021	DGRP-026	DGRP-028	DGRP-031	DGRP-032	DGRP-038	DGRP-040	DGRP-041	DGRP-042	DGRP-045	DGRP-048	DGRP-049	DGRP-057	DGRP-059	DGRP-069	DGRP-073	DGRP-075	DGRP-083	DGRP-085	DGRP-088	DGRP-091	DGRP-093	DGRP-100	DGRP-101	DGRP-105	DGRP-109	DGRP-129	DGRP-136	DGRP-138	DGRP-142	DGRP-149	DGRP-153	DGRP-158	DGRP-161	DGRP-176	DGRP-177	DGRP-181	DGRP-189	DGRP-195	DGRP-208	DGRP-217	DGRP-223	DGRP-227	DGRP-228	DGRP-229	DGRP-233	DGRP-235	DGRP-237	DGRP-239	DGRP-256	DGRP-280	DGRP-287	DGRP-301	DGRP-303	DGRP-304	DGRP-306	DGRP-307	DGRP-309	DGRP-310	DGRP-313	DGRP-315	DGRP-317	DGRP-318	DGRP-319	DGRP-320	DGRP-321	DGRP-324	DGRP-325	DGRP-332	DGRP-335	DGRP-336	DGRP-338	DGRP-340	DGRP-348	DGRP-350	DGRP-352	DGRP-354	DGRP-355	DGRP-356	DGRP-357	DGRP-358	DGRP-359	DGRP-360	DGRP-361	DGRP-362	DGRP-365	DGRP-367	DGRP-370	DGRP-371	DGRP-373	DGRP-374	DGRP-375	DGRP-377	DGRP-379	DGRP-380	DGRP-381	DGRP-382	DGRP-383	DGRP-385	DGRP-386	DGRP-390	DGRP-391	DGRP-392	DGRP-395	DGRP-397	DGRP-399	DGRP-405	DGRP-406	DGRP-409	DGRP-426	DGRP-427	DGRP-437	DGRP-439	DGRP-440	DGRP-441	DGRP-443	DGRP-461	DGRP-486	DGRP-491	DGRP-492	DGRP-502	DGRP-505	DGRP-508	DGRP-509	DGRP-513	DGRP-517	DGRP-528	DGRP-530	DGRP-531	DGRP-535	DGRP-551	DGRP-555	DGRP-559	DGRP-563	DGRP-566	DGRP-584	DGRP-589	DGRP-595	DGRP-596	DGRP-627	DGRP-630	DGRP-634	DGRP-639	DGRP-642	DGRP-646	DGRP-703	DGRP-705	DGRP-707	DGRP-712	DGRP-714	DGRP-716	DGRP-721	DGRP-727	DGRP-730	DGRP-732	DGRP-737	DGRP-738	DGRP-748	DGRP-757	DGRP-761	DGRP-765	DGRP-774	DGRP-776	DGRP-783	DGRP-786	DGRP-787	DGRP-790	DGRP-796	DGRP-799	DGRP-801	DGRP-802	DGRP-804	DGRP-805	DGRP-808	DGRP-810	DGRP-812	DGRP-818	DGRP-819	DGRP-820	DGRP-821	DGRP-822	DGRP-832	DGRP-837	DGRP-843	DGRP-849	DGRP-850	DGRP-852	DGRP-853	DGRP-855	DGRP-857	DGRP-859	DGRP-861	DGRP-879	DGRP-882	DGRP-884	DGRP-887	DGRP-890	DGRP-892	DGRP-894	DGRP-897	DGRP-900	DGRP-907	DGRP-908	DGRP-911	DGRP-913
2L	2262	.	T	TTC	.	PASS	AC=20	GT	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	1/1	0/0	0/0	0/0	1/1	0/0	0/0	0/0	1/1	0/0	0/0	1/1	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	1/1	0/0	0/0	0/0	0/0	1/1	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	1/1	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	0/0	1/1	0/0	0/0	0/0
2L	4943	.	TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGTG	T,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATAACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGAATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATAACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATAACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGAATATTATTTTCTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGAATATTTAGATTGCCTATT,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTATT,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTATTTTCTCTCCCATATTATAGAGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATT,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGAGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCTCATGTTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAAGAGATATTTAGATTGCCTCTCATTTTCTCTCTCATGTTATAGAGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTCTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTCTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTTTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTTAGATTGCCTCTCATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAACAATGCACGACAGAGGAAGCAGAACAGATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAATATTATTTTCTCTCCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAATATTATTTTTTCACCCATATTATAGGGTG,TAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTTCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATTAAATATTATTTTTTCACCCATATTATAGGGTG	.	PASS	AC=14,1,6,1,1,1,2,10,1,1,1,1,1,1,1,2,121,2,1,3,3,6,1,3,2	GT	17/17	1/1	17/17	17/17	1/1	17/17	17/17	17/17	0/17	17/17	24/7	17/18	0/17	0/0	17/17	0/0	17/1	17/17	17/17	17/8	17/8	17/17	24/17	0/0	0/0	17/17	17/17	17/17	1/8	1/0	0/0	17/18	17/17	17/17	8/9	1/1	0/0	17/17	0/0	0/0	0/0	17/22	17/8	17/17	0/0	17/17	17/17	20/6	0/0	0/0	17/17	0/0	25/17	17/17	0/0	0/0	17/17	0/0	17/17	0/10	17/17	17/17	17/17	17/17	17/21	17/17	17/17	0/0	17/17	17/17	17/17	17/17	12/11	17/22	17/17	17/17	17/17	17/17	0/0	17/21	17/17	17/17	0/0	17/22	17/17	17/17	17/17	0/0	17/17	17/17	0/0	17/17	17/17	0/0	17/17	17/17	17/22	0/0	17/8	0/0	17/22	17/17	17/17	17/17	17/15	17/17	17/17	1/8	1/0	17/17	17/17	0/0	0/0	17/17	17/17	17/17	0/0	7/7	0/0	17/17	0/0	17/17	0/0	0/0	0/0	17/16	22/5	17/17	0/0	0/0	0/0	0/0	17/19	17/17	0/0	1/8	17/17	17/17	17/17	13/23	24/14	17/17	3/4	0/0	17/17	0/0	0/0	17/20	3/3	17/17	17/17	17/17	17/17	17/21	0/0	17/17	0/0	1/1	0/0	17/17	0/0	17/17	0/0	3/3	0/0	0/0	17/17	3/3	17/17	17/1	17/1	0/0	17/16	17/17	0/0	17/17	17/17	17/1	17/17	3/3	17/17	0/0	25/25	0/0	20/2	17/17	17/17	17/17	0/0	17/17	0/0	17/17	0/0	0/0	17/17	17/17	0/0	3/3	1/8	17/17	17/17	17/8	0/0	17/17	17/17

 


 

Tool name: Realigner Target Creator
Tool version: 0.0.4
Tool ID: toolshed.g2.bx.psu.edu/repos/devteam/realigner_target_creator/gatk_realigner_target_creator/0.0.4
ToolShed URL: https://toolshed.g2.bx.psu.edu/view/devteam/realigner_target_creator

 

realigner-target-creator • 1.3k views
ADD COMMENTlink modified 3.2 years ago by Bjoern Gruening5.0k • written 3.2 years ago by Guy Reeves1.0k
3
gravatar for Bjoern Gruening
3.2 years ago by
Bjoern Gruening5.0k
Germany
Bjoern Gruening5.0k wrote:

Hi,

ROD simply mean reference ordered data and is a VCF file in this context.

Hope this helps,

Bjoern

ADD COMMENTlink written 3.2 years ago by Bjoern Gruening5.0k

Thanks Bjoerm. Once I sorted the file it worked.

ADD REPLYlink written 3.2 years ago by Guy Reeves1.0k

HI 

I have looked in the documentation on the GATK site but i cannot find out the significance or an explanation of 'Binding Type:'

 dbSNP SNPs INDELs Custom 

I have been using Custom and it appears to work for the 'binned' .vcf file I am using (explanation ftp://ftp.hgsc.bcm.edu/DGRP/freeze2_Feb_2013/vcf_files/Difference_between_bin_and_regular_vcf_file.txt )

Thanks

Guy

 

 

 

 

ADD REPLYlink written 3.2 years ago by Guy Reeves1.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 131 users visited in the last hour