Question: Problem Mapping 454 Reads In Fastq Format Using Lastz
0
Chris.Howard@csiro.au • 10 wrote:
Dear Galaxy Team and users,
I have some 454 reads that I would like to map against a contig
assembly using LASTZ. I have already mapped the reads uploaded in
fasta format against the assembly but, as mapping the reads in fasta
ignores the base qualities that would be present in a fastq file, I am
concerned that I might need the base quality information that may be
crucial in deciding on 'real' SNPs later down the line. So, as LASTZ
apparently recognises fastq (*see below), I converted the reads to
fastq using the 'Combine fasta and qual' tool in Galaxy and I am now
currently trying to map the reads to the assembly. However, Galaxy
would not recognise the fastq reads in the LASTZ input page. So I
tried to fool it by changing the data type of the fastq to fasta using
the 'Edit attributes' function of the history. This kept the fastq
info but allowed Galaxy to recognise the file as input for LASTZ.
However, this mapping has been running for almost 24 hours now and so
I am concerned that there is an error.
Is anyone able offer any help with why Galaxy does not recognise the
reads in fastq format prior to mapping with LASTZ?
Here are what the first two reads look like in fastq format:
@GIQ547K01A7QJK length=76 xy=0381_0142 region=1
run=R_2010_06_11_16_16_09_
GCTTCGTGTGCGACGACACTCGTCATCGACAACGCAAGACTGGCGCTATCGCAATTGGACACACAACATG
TGACCG
+
27 19 17 17 18 19 11 14 14 17 19 17 22 17 17 14 14 14 17 19 17 19 17
17 19 19 25 25 22 17 12 13 14 19 21 21 21 27 21 19 19 17 17 19 17 24
25 22 20 22 22 17 16 16 12 12 12 12 19 22 17 17 17 20 20 22 27 21 25
22 20 20 22 21 16 12
@GIQ547K01AE4BG length=40 xy=0055_0266 region=1
run=R_2010_06_11_16_16_09_
GTGACTAGATACATGCAATCAATTGTCCATGTCATTCGAG
+
27 23 23 19 19 19 18 19 21 19 18 19 18 25 27 27 26 26 27 27 27 27 27
19 19 18 19 19 27 27 25 24 25 25 21 21 22 22 22 18
* Input formats (copied from the LASTZ input page in Galaxy)
LASTZ accepts reference and reads in FASTA format. However, because
Galaxy supports implicit format conversion the tool will recognize
fastq and other method specific formats.
With thanks,
Chris
ADD COMMENT
• link
•
modified 7.2 years ago
by
Jennifer Hillman Jackson ♦ 25k
•
written
7.2 years ago by
Chris.Howard@csiro.au • 10
