Question: How to align sequences with MAFFT
0
gravatar for winklma01
4 months ago by
winklma01 • 0
winklma01 • 0 wrote:

I want to align two FASTA sequences. I am trying to use MAFFT , Multialign tool in Galaxy. Does this program want two sequences next to each other in a FASTA file? It will not take two FASTA files to align the sequences from those two files. I have tried merging two FASTA files and inputting that merged file with no results.

fasta input alignment galaxy mafft • 202 views
ADD COMMENT • link • modified 4 months ago by Jennifer Hillman Jackson ♦ 25k • written 4 months ago by winklma01 • 0
0
gravatar for Jennifer Hillman Jackson
4 months ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:

Hello,

The two sequences should be stacked one on top of each other (tool: Concatenate), in strict fasta format (tool: NormalizeFasta), and have unique identifiers.

FAQs for Custom genomes/fasta -- the formatting rules also apply to most other tools that accept fasta format inputs (for any input parameter)

Galaxy FAQs, including the above: https://galaxyproject.org/support/

Galaxy Tutorials: https://galaxyproject.org/learn/

There are two Public usegalaxy* servers with this tool installed. Galaxy Europe: https://usegalaxy.eu and Galaxy Main https://usegalaxy.org: MAFFT Multiple alignment program for amino acid or nucleotide sequences (Galaxy Version 7.221.3).

I just tested it with two very small sequences, that had some overlap, in proper fasta format, using all defaults, and achieved a successful result for both FASTA and ClustalW output (Phylip output is not supported at this server, as noted under the output format selection help, and will trigger a job failure). If you want to compare your input data to the test data I used, this is the content of the fasta:

>seq1
GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA
GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
>seq2
GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT

Thanks! Jen, Galaxy team

ADD COMMENT • link modified 4 months ago • written 4 months ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 175 users visited in the last hour