Question: How to align sequences with MAFFT
0
gravatar for winklma01
14 days ago by
winklma010
winklma010 wrote:

I want to align two FASTA sequences. I am trying to use MAFFT , Multialign tool in Galaxy. Does this program want two sequences next to each other in a FASTA file? It will not take two FASTA files to align the sequences from those two files. I have tried merging two FASTA files and inputting that merged file with no results.

ADD COMMENTlink modified 13 days ago by Jennifer Hillman Jackson25k • written 14 days ago by winklma010
0
gravatar for Jennifer Hillman Jackson
13 days ago by
United States
Jennifer Hillman Jackson25k wrote:

Hello,

The two sequences should be stacked one on top of each other (tool: Concatenate), in strict fasta format (tool: NormalizeFasta), and have unique identifiers.

FAQs for Custom genomes/fasta -- the formatting rules also apply to most other tools that accept fasta format inputs (for any input parameter)

Galaxy FAQs, including the above: https://galaxyproject.org/support/

Galaxy Tutorials: https://galaxyproject.org/learn/

There are two Public usegalaxy* servers with this tool installed. Galaxy Europe: https://usegalaxy.eu and Galaxy Main https://usegalaxy.org: MAFFT Multiple alignment program for amino acid or nucleotide sequences (Galaxy Version 7.221.3).

I just tested it with two very small sequences, that had some overlap, in proper fasta format, using all defaults, and achieved a successful result for both FASTA and ClustalW output (Phylip output is not supported at this server, as noted under the output format selection help, and will trigger a job failure). If you want to compare your input data to the test data I used, this is the content of the fasta:

>seq1
GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA
GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
>seq2
GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT
TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT

Thanks! Jen, Galaxy team

ADD COMMENTlink modified 13 days ago • written 13 days ago by Jennifer Hillman Jackson25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 105 users visited in the last hour