Question: Picard Alignment Summary Metrics Failure
gravatar for Huge, Andreas
7.0 years ago by
Huge, Andreas10 wrote:
Hello, When I use the NGS Picard tool "SAM/BAM alignment summary metrics" with a BAM file produced with Tophat in Galaxy I get the following message: INFO:root:## executing java -Xmx4g -jar /galaxy/home/g2main/galaxy_main/tool- data/shared/jars/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=1000 OUTPUT=/galaxy/main_ pool/pool5/tmp/job_working_directory/2368774/dataset_2672529_files/Col lectAlignmentSummaryMetrics.metrics.txt R=/galaxy/main_pool/pool5/tmp/ job_working_directory/2368774/dataset_2672529_files/mm9.fa_fake.fasta TMP_DIR=/tmp INPUT=/galaxy/main_database/files/002/666/dataset_2666199.dat returned status 1 and stderr: [Mon Jul 11 03:27:56 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=1000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTC TTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/galaxy/main_database/files/002/666/dataset_2666199.dat OUTPUT=/ galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_26725 29_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE =/galaxy/main_pool/pool5/tmp/job_working_directory/2368774/dataset_267 2529_files/mm9.fa_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false [Mon Jul 11 03:27:57 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done. Runtime.totalMemory()=507379712 Exception in thread "main" java.lang.IllegalArgumentException: No enum const class net.sf.samtools.SAMFileHeader$SortOrder.sorted at java.lang.Enum.valueOf( at net.sf.samtools.SAMFileHeader$SortOrder.valueOf( at net.sf.samtools.SAMFileHeader.getSortOrder( at net.sf.picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSa at net.sf.picard.analysis.SinglePassSamProgram.doWork(SinglePassSamP at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLine at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(Com at net.sf.picard.analysis.CollectAlignmentSummaryMetrics.main(Collec If I use the NGS: Picard BAM Index Statistics, the script is running without any failure so I think the BAM format should be okay. Any help would be gratefully received. Thanks. Andreas Huge
samtools bam • 1.4k views
ADD COMMENTlink written 7.0 years ago by Huge, Andreas10
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 117 users visited in the last hour