Question: Cufflinks Fpkm Problem
0
gravatar for lishiyong
7.6 years ago by
lishiyong • 50
lishiyong • 50 wrote:
Hi£º I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) £¬which is better for solid data mapping ,so I don't use the bowtie to map . £Égain the BAM file!¡¡Now ,I want use the cufflinks to calculate the gene expression. But there is a error. [15:08:06] Inspecting reads and determining fragment length distribution. BAM record error: found spliced alignment without XS attribute BAM record error: found spliced alignment without XS attribute the BAM file : 323_358_2010 73 chr1 343 0 45M5H * 0 0 CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT IIIIIIIIIII))C/1<de''@dahd379aid1;7bi+'7))i?3 rg:z:20110328192522421="" nh:i:0="" cm:i:4="" sm:i:2="" cq:z:a="ABA&lt;&lt;">@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000 423_236_1955 81 chr1 550 0 8H42M = 699451 698945 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:5 SM:i:3 CQ:Z:9BA<aab>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223 298_1884_1495 113 chr1 562 0 7H43M chr3 199392032 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG 5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:0 SM:i:3 CQ:Z:BB@7<ab8@aba=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022 62_1428_1954 89 chr1 562 1 50M * 0 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:0 CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=
ADD COMMENT • link • modified 7.6 years ago • written 7.6 years ago by lishiyong • 50
0
gravatar for Ryan Golhar
7.6 years ago by
Ryan Golhar • 80
Ryan Golhar • 80 wrote:
Cufflinks requires an 'xs' tag on each read in the bam file. Only tophat does this. You can write a script to add this or remap with tophat. How much of a difference do you see between tophat and bioscope? Please excuse any typos -- Sent from my iPhone
ADD COMMENT • link written 7.6 years ago by Ryan Golhar • 80
0
gravatar for Paul Korir
7.6 years ago by
Paul Korir • 20
Paul Korir • 20 wrote:
Hi Li, Tophat includes a custom tag 'XS' at the end of spliced read alignments which your pipeline is not aware about. The following is taken from http://cufflinks.cbcb.umd.edu/manual.html "Cufflinks takes a text file of SAM alignments as input. For more details on the SAM format, see the specification<http: samtools.sourceforge.net="" sam1.pdf="">. The RNA-Seq read mapper TopHat <http: tophat.cbcb.umd.edu=""/> produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept: s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it *must* be present for all spliced alignment records (those with a 'N' operation in the CIGAR string)." Kind regards, Paul 2011/4/11 lishiyong <lishiyong@genomics.org.cn> -- Paul Korir www.paulkorir.com
ADD COMMENT • link written 7.6 years ago by Paul Korir • 20
0
gravatar for gaohuan
7.6 years ago by
gaohuan • 10
gaohuan • 10 wrote:
Thank you very much for your reply! I'd like to know how to add this 'xs' tag since the amount of reads mapped to genome is much less using tophat, can we just add a '+' or '-' at the end of each line? 2011-04-11 gaohuan 发件人: Ryan Golhar 发送时间: 2011-04-11 23:19:10 收件人: lishiyong 抄送: tophat.cufflinks; galaxy-user; 高欢 主题: Re: [galaxy-user] cufflinks FPKM problem Cufflinks requires an 'xs' tag on each read in the bam file. Only tophat does this. You can write a script to add this or remap with tophat. How much of a difference do you see between tophat and bioscope? Please excuse any typos -- Sent from my iPhone Hi: I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ,which is better for solid data mapping ,so I don't use the bowtie to map . Igain the BAM file! Now ,I want use the cufflinks to calculate the gene expression. But there is a error. [15:08:06] Inspecting reads and determining fragment length distribution. BAM record error: found spliced alignment without XS attribute BAM record error: found spliced alignment without XS attribute the BAM file : 323_358_2010 73 chr1 343 0 45M5H * 0 0 CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT IIIIIIIIIII))C/1<de''@dahd379aid1;7bi+'7))i?3 rg:z:20110328192522421="" nh:i:0="" cm:i:4="" sm:i:2="" cq:z:a="ABA&lt;&lt;">@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000 423_236_1955 81 chr1 550 0 8H42M = 699451 698945 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:5 SM:i:3 CQ:Z:9BA<aab>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223 298_1884_1495 113 chr1 562 0 7H43M chr3 199392032 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG 5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:0 SM:i:3 CQ:Z:BB@7<ab8@aba=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022 62_1428_1954 89 chr1 562 1 50M * 0 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:0 CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=
ADD COMMENT • link written 7.6 years ago by gaohuan • 10
Since SOLiD reads are strand-specific you can use the option '--library-type fr-secondstrand', and the strand information will automatically be added to the reads during the run. -Adam
ADD REPLY • link written 7.6 years ago by Adam Roberts • 10
0
gravatar for lishiyong
7.6 years ago by
lishiyong • 50
lishiyong • 50 wrote:
Hi,Paul Korir: Thank you for yours help.I have known the reason,But I also I have a little problem about to solve the question. if I want to add a XS tag ,what should I do ,can you tell me in detail(like that ,dose it only have two value ,such as XS:A:-,XS:A:+ ,not have XS:B([B-Z]):+ ? Best wishes 发件人: "Paul Korir" <polariseke@gmail.com> 收件人: "lishiyong" <lishiyong@genomics.org.cn> 抄送: "tophat.cufflinks" <tophat.cufflinks@gmail.com>, "galaxy-user" <galaxy-user@lists.bx.psu.edu>, "高欢" <gaohuan@genomics.org.cn> 发送时间: 星期一, 2011年 4 月 11日 下午 11:10:56 主题: Re: [galaxy-user] cufflinks FPKM problem Hi Li, Tophat includes a custom tag 'XS' at the end of spliced read alignments which your pipeline is not aware about. The following is taken from http://cufflinks.cbcb.umd.edu/manual.html "Cufflinks takes a text file of SAM alignments as input. For more details on the SAM format, see the specification . The RNA-Seq read mapper TopHat produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept: s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- Note the use of the custom tag XS . This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a 'N' operation in the CIGAR string)." Kind regards, Paul 2011/4/11 lishiyong < lishiyong@genomics.org.cn > Hi: I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ,which is better for solid data mapping ,so I don't use the bowtie to map . Igain the BAM file! Now ,I want use the cufflinks to calculate the gene expression. But there is a error. [15:08:06] Inspecting reads and determining fragment length dis tribution. BAM record error: found spliced alignment without XS attribute BAM record error: found spliced alignment without XS attribute  the BAM file : 323_358_2010    73      chr1    343     0        45M5H   *       0       0       CCCTAACCCT ACCCTAACCCTAACCCTAACCCTAACCCTAACCCT   IIIIIIIIIII))C/1<de''@dahd379 aid1;7bi+'7))i?3   rg:z:20110328192522421   nh:i:0  cm:i:4  ="" sm:i:2  cq:z:a="ABA&lt;&lt;">@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS: Z:T20023010023110230100030100230100230100030000200000 423_236_1955    81      chr1    550     0        8H42M   =       699451  698945  GTGCAGAGGAGAACGCAGCT CCGCCCTCGCGGTGCTCTCCGG      GF>IIII%%III))8IIII?IIII%%IIIIIIIIII IIIIII      RG:Z:20110328192522421   NH:i:2  CM:i:5  SM:i :3  CQ:Z:9BA<aab>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T2 0302222311033322303302232133302223222131122330223 298_1884_1495   113     chr1    562     0        7H43M   chr3    199392032       0       ACGCAGC TCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG     5AI;6:>AIIII>?I7FIEIIIII IIIIIIIIIIIIIIIIIII      RG:Z:20110328192522421  NH:i:2  CM: i:0  SM:i:3  CQ:Z:BB@7<ab8@aba=2;=>82:?A388.A&28(77;64.1*-/<&0:9/% 3? CS:Z:T20221231112210030222231103332200330223213312222022 62_1428_1954    89      chr1    562     1        50M     *       0       0       ACGCAGCT CCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC      *=AIII4/CII=%%I( (=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII       RG:Z:20110328192522421   NH:i:0  CM:i:4  SM:i:0  CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=
ADD COMMENT • link written 7.6 years ago by lishiyong • 50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 168 users visited in the last hour