User: chanwoo1143

gravatar for chanwoo1143
New User
Last seen:
2 years, 2 months ago
2 years, 2 months ago

Posts by chanwoo1143

<prev • 11 results • page 1 of 2 • next >
Comment: C: Hello help for annovar..
... is the history; there are three gene sets one from mom, one from dad, and one from daughter. I need to find the SNPs from the reference genome homo sapiens hg 19. I am a bit kinda clueless how to proceed or if I have done these works correctly. ...
written 2.2 years ago by chanwoo114310
Hello help for annovar..
... I need some help.. I have this . Using your resulting VCF determine 1) the number of single nucleotide variants, 2) the number of insertion/deletion variants, 3) the number of multi-necleotide variants, 4) the number of variants with multiple alternate alleles, and 5) the names of the 5 genes with t ...
galaxy written 2.2 years ago by chanwoo114310
Problem with installing galaxy data into my git bash!
... Hi, I have some problem intstalling galaxy data into my git bash. My version is version When I entered this code in git hub git clone , it produced this message "$ fatal: could not create work tree dir 'galaxy': Permission denied bash: ...
galaxy written 2.2 years ago by chanwoo114310
Answer: A: How to find CpG sites on chromosome 17 in human using galaxy
... Hi, this is email I got from the author 3 days ago. Dear chanwoo, Thank you for your email. We have provided a online calculator to predictor biological age using three CpG sites. Please go to for details. Best, wishes, Qiong Lin In t ...
written 2.2 years ago by chanwoo114310
Answer: A: How to find CpG sites on chromosome 17 in human using galaxy
... Thank you for the help. These are the source sequences for each CpG islands. cg25809905 36 17 39823254 NCBI:RefSeq 36.1 CCAAGAGTAAACAGTGTGCTCAATGCTGTGCCTACGTGTGTTAGCCCACG 39822399 - GeneID:3674 ITGA2B cg02228185 36 17 3326317 NCBI:RefSeq 36.1 GGTTAGTAATAAATGGTTTTACCTCCAGCCCTGTTCTCTGAATCTCAGCG 332 ...
written 2.2 years ago by chanwoo114310
Answer: A: How to find CpG sites on chromosome 17 in human using galaxy
... I have published my work here: Regards, Chanwoo ...
written 2.2 years ago by chanwoo114310
Answer: A: How to find CpG sites on chromosome 17 in human using galaxy
... Sorry, but I am not sure what you are meaning to say specifically; it almost sounds poetic... ...
written 2.2 years ago by chanwoo114310
Comment: C: How to find CpG sites on chromosome 17 in human using galaxy
... Hi, I am not at all familiar with github. There are some written programs which i have no skill to work on unfortunately. Is there some other way(e.g. galaxy tool)? Regards, Chanwoo ...
written 2.2 years ago by chanwoo114310
Answer: A: How to find CpG sites on chromosome 17 in human using galaxy
... Hello, I really appreciate your answer; my question may seem irresponsible, but I study in 3rd year in netherlands. I only found this galaxy website through coursera. I still do not know a lot about how to work with them as I have not had any proper bioinformatics course. This is for my project car ...
written 2.2 years ago by chanwoo114310
How to find CpG sites on chromosome 17 in human using galaxy
... I would like to know how to find CpG sites on chromosome 17 in human (homo sapiens) using galaxy. I have used ucsc database to do so, but did not get anything out of it. There are the CpG sites I need to find out (cg02228185 in ASPA, cg25809905 in ITGA2B, and cg17861230 in PDE4C), and I know their s ...
cpg islands mapping written 2.2 years ago by chanwoo114310

Latest awards to chanwoo1143

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 79 users visited in the last hour