User: meeran_micro

gravatar for meeran_micro
Reputation:
0
Status:
New User
Location:
Malaysia
Last seen:
2 years, 7 months ago
Joined:
2 years, 7 months ago
Email:
m***********@yahoo.co.in

Posts by meeran_micro

<prev • 3 results • page 1 of 1 • next >
0
votes
2
answers
611
views
2
answers
Convert FASTAQ file into plain text whole genome sequence
... I have a FASTAQ file containing millions of sequences and I want a simple script to convert this file into one long sequence. ie delete all headers and remove any spaces and line breaks. I can always add a ">seq_name" to the first line afterwards, so maintaining the top header is not necessary. I ...
sequence format sequence written 2.6 years ago by meeran_micro0 • updated 2.6 years ago by Jennifer Hillman Jackson25k
0
votes
2
answers
798
views
2
answers
Answer: A: Unable to convert FASTAQ file into NCBI standered FASTA file format
... Sample of my input FASTAQ file, >20351#1/1 TAAAAGCNGGTTATGTTGTCGCTTTACGGTTTTCATTCAGGACGCGCTATGGGCAATAAGTATTCCGGCCTGCAAATTGGTATTCACTGGTTAGTCTTTT >23523#1/1 TATCGCGNCGTTTTTACGCTGGCGTCACCGTCACCAATAAACCTTAGCGCGCTGGAGGAAATATCCCAGCGCGAAATTTATCGCCCCATAAACCGCGCCC Sample of my output FASTA file shoul ...
written 2.6 years ago by meeran_micro0
0
votes
2
answers
798
views
2
answers
Unable to convert FASTAQ file into NCBI standered FASTA file format
... Hi I wanted align multiple alignment of several Salmonella Typhi isolates in bioedit software. I have FASTAQ Sanger file format sequences. In order to upload into Bioedit software I need FASTA file format in NCBI standered format. I used FASTAQ TO FASTA option in Galaxy. But output of single genome ...
fastaq fasta alignment written 2.6 years ago by meeran_micro0

Latest awards to meeran_micro

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 147 users visited in the last hour