User: srodriguezmar

Reputation:
0
Status:
New User
Location:
Israel
Last seen:
2 years, 5 months ago
Joined:
2 years, 5 months ago
Email:
s************@gmail.com

Posts by srodriguezmar

<prev • 2 results • page 1 of 1 • next >
0
votes
2
answers
613
views
2
answers
Answer: A: Problems converting a file to FASTA
... Thank you! I will check it out!   ...
written 2.5 years ago by srodriguezmar0
2
votes
2
answers
613
views
2
answers
Problems converting a file to FASTA
... Hello! How are you? I am having a hard time converting a file. I have  FASTA formatted sequences from a Roche (454) FLX sequencing run. They look like this: >an-52_GO0Z3GB03HJJ8X    bdiffs=0(match) fpdiffs=0(match)      rank=0000442 x=2976.5 y=431.0 length=430 CCCGCTTTCTCCCTCAGGACGTATGCGGTATTAG ...
galaxy convert fasta written 2.5 years ago by srodriguezmar0

Latest awards to srodriguezmar

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 81 users visited in the last hour