User: shamsher jagat

gravatar for shamsher jagat
United States
Last seen:
8 months ago
7 years ago

Posts by shamsher jagat

<prev • 66 results • page 1 of 7 • next >
GRCH37 vs hg19 vs B37 vs canonincal
... In galaxy which human genome should be compatible with GRCH37 annotation for alignment. I uploaded fastq with GRCH37 genome, when I look at alignment options with HISAt it offers- b37/ hg19 canonical/ hg19 male/ female. Which genome should be used so that it should be compatible with GRCH37 annotati ...
rna-seq written 8 months ago by shamsher jagat590 • updated 8 months ago by Jennifer Hillman Jackson25k
Comment: C: gtf files for xenopus in galaxy instance
... Jen, Thanks how can I access FASTA file corresponding to above GTF with in Galaxy, I realized that XenTro9 is there when I upload the data but is not available in the listed genome files for HISAt alignments. Thanks ...
written 8 months ago by shamsher jagat590
gtf files for xenopus in galaxy instance
... Galaxy has Xenopus tropicalis genome XenTro9 vesrion for alignment, which annotation file (gff or GTF file) should be used after alignment? ...
gtf test-tablebrower xentro9 ucsc written 8 months ago by shamsher jagat590 • updated 8 months ago by Jennifer Hillman Jackson25k
Bacterial RNAseq in Galaxy
... Is there a workflow to follow alignment of bacterial RNAseq. I want to align FAStq file and then find out level of rRNA and small RNA in the samples. Thanks ...
rna-seq written 14 months ago by shamsher jagat590 • updated 14 months ago by Jennifer Hillman Jackson25k
DESeq in Galaxy
... Can someone point me if there are sample work flows for running DESeq with in galaxy after running Tophat. Thanks ...
galaxy written 15 months ago by shamsher jagat590 • updated 15 months ago by Jennifer Hillman Jackson25k
Adapter trimming in basespace
... I have used NuGEN RNA-seq kit and adapter sequence. is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (TruSeq Universal Adapter) However in base space (FASTqToolkit) closest one is True seq dual HT/LT but it is not completely matching Another option is Ht/Lt common seq of 12 base ...
adapter trimming general question written 2.0 years ago by shamsher jagat590 • updated 2.0 years ago by Jennifer Hillman Jackson25k
miRNA sequencing alignment
... i have a rna-seq data and would like to align it against micro RNA human. Can I do it in galaxy. I dont see miRNA as genome in pulldown menu thanks Kanwar ...
mirna written 2.1 years ago by shamsher jagat590 • updated 2.1 years ago by y.hoogstrate460
Question about galaxy tool wrapper
... I want to use Bismark tool which is in galaxy tool shed Can some one point me how best I can use it . Are there any specific steps summarized which I can follow to use this wrapper into local galaxy instance. ...
wrapper galaxy bismark written 3.1 years ago by shamsher jagat590 • updated 3.1 years ago by Jennifer Hillman Jackson25k
Using Snpeff And Snpsift In Galaxy
... I have a VCF file and I want to filter it for nonsynonymous/ deletion/ insertion seq variations. Once I filter this file and compare between tumor vs normal samples and then annotate such variations. I believe I can filter this file using SnpSift and then can annotate with SnpEff, When I try to us ...
snp snpeff written 4.4 years ago by shamsher jagat590 • updated 4.4 years ago by Jennifer Hillman Jackson25k
Comment: C: Bam Qc And Coverage
... Joachim , Thanks that is exactly I was looking as Qualimap is exhausting memory. Thanks Geert. On Fri, Sep 6, 2013 at 12:32 AM, Joachim Jacob | VIB | ...
written 4.7 years ago by shamsher jagat590

Latest awards to shamsher jagat

Popular Question 14 months ago, created a question with more than 1,000 views. For Bam Qc And Coverage
Popular Question 14 months ago, created a question with more than 1,000 views. For Combining Two Fastq Files
Popular Question 14 months ago, created a question with more than 1,000 views. For Bed To Bam Conversion In Galaxy
Popular Question 14 months ago, created a question with more than 1,000 views. For Bcf To Vcf
Popular Question 14 months ago, created a question with more than 1,000 views. For Ceas In Galaxy
Popular Question 14 months ago, created a question with more than 1,000 views. For Genomic Coordinates To Enterz Gene Ids
Popular Question 14 months ago, created a question with more than 1,000 views. For Copy Number Variation Detcetion In Glaxay
Popular Question 14 months ago, created a question with more than 1,000 views. For Bed To Wiggle?
Popular Question 14 months ago, created a question with more than 1,000 views. For Mm9 Reference Gtf File For Cuffcompare
Popular Question 22 months ago, created a question with more than 1,000 views. For Genomic Coordinates To Enterz Gene Ids
Popular Question 22 months ago, created a question with more than 1,000 views. For Combining Two Fastq Files
Popular Question 22 months ago, created a question with more than 1,000 views. For Fastq Sanger To Illumina Fastq
Popular Question 22 months ago, created a question with more than 1,000 views. For Bed To Bam Conversion In Galaxy
Popular Question 22 months ago, created a question with more than 1,000 views. For Ceas In Galaxy
Popular Question 24 months ago, created a question with more than 1,000 views. For Genomic Coordinates To Enterz Gene Ids
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Genomic Coordinates To Enterz Gene Ids
Popular Question 3.0 years ago, created a question with more than 1,000 views. For Using Snpeff And Snpsift In Galaxy


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 87 users visited in the last hour