User: PaulW

gravatar for PaulW
PaulW50
Reputation:
50
Status:
Trusted
Location:
Last seen:
41 minutes ago
Joined:
6 years, 8 months ago
Email:
p*******@uni.sydney.edu.au

Posts by PaulW

<prev • 11 results • page 1 of 2 • next >
0
votes
0
answers
1
views
0
answers
'print reads' throwing 'eof marker is absent' on my BAM file
... Yes I've read many of the posts out there about 'BAM EOF absent', but can't find a resolution. I'm working through a DNA analysis. All going fine until I try to run **print reads** which throws: *[bam_header_read] EOF marker is absent. The input is probably truncated. [bam_header_read] invalid BAM ...
bam print reads written 41 minutes ago by PaulW50
0
votes
2
answers
23
views
2
answers
Answer: A: Where to get SNPs and Indels?
... Thanks for your help. It turns out that Picard ReorderSAM allows sorting the BAM to match the reference file from Broad which then makes everything work fine :-) ...
written 2 days ago by PaulW50
0
votes
2
answers
23
views
2
answers
Where to get SNPs and Indels?
... I downloaded some files from Broad Institute but Realigner Target Creator won't work with these files because the sort order is different to my BAM file. /hg19/Mills_and_1000G_gold_standard.indels.hg19.sites.vcf /hg19/dbsnp_138.hg19.excluding_sites_after_129.vcf /hg19/ucsc.hg19.fasta I can't sort ...
realigner target creator written 4 days ago by PaulW50
0
votes
1
answer
87
views
1
answers
Comment: C: Select FASTQ reads by sequence
... Jenn, Thanks for that interesting suggestion. Unfortunately Lastz doesn't process fastq files. Worse, the galaxy implementation of Lastz apparently doesn't expose the "--ambiguous=iupac" command line option so converting fastq to fasta didn't work. I'll keep searching. There's a couple of things in ...
written 9 weeks ago by PaulW50
0
votes
1
answer
87
views
1
answers
Comment: C: Select FASTQ reads by sequence
... BTW the FASTQ reads are 150 base Illumina reads ...
written 9 weeks ago by PaulW50
0
votes
1
answer
87
views
1
answer
Select FASTQ reads by sequence
... Which tool should I use to select all reads from a FASTQ file which include any of about 100 short sequences given in a file such as: ACAGTCAGCTAGCATCGATCCTAGCTAGAC GCATCACGACTACGACGTACATCTAGCATG etc Is there a tool in Galaxy which will do this? Alternatively would BBDUK work for this? ...
fastq written 9 weeks ago by PaulW50 • updated 9 weeks ago by Jennifer Hillman Jackson21k
0
votes
1
answer
426
views
1
answer
Processing Gff3 File Of Variants
... Hello all, I have a GFF3 file of variants from nextgen sequencing and want to find non-synonymous changes. Any suggestions? One possible way would be: 1. Use tool "Compute an expression on every row" to extract the reference allele and sample allele from column 9 (attributes column) of the GFF3 f ...
gff written 6.6 years ago by PaulW50 • updated 6.6 years ago by Mary Mangan40
0
votes
1
answer
403
views
1
answers
Comment: C: File Formats In Workflows
... Dannon, Thanks for your interest. It would be a handy feature to be able to attach metadata to tabular files in the workflow. I have shared the workflow. It is called 'chr21 analysis'. Input is a gene BED file for a chromosome region from UCSC data (which includes gene variants). Workflow fails aft ...
written 6.7 years ago by PaulW50
0
votes
1
answer
403
views
1
answer
File Formats In Workflows
... Hi, Was impressed by the Worflow screencasts but when I converted my history to a workflow it failed. This is because some of the tools output tabular data, but some downstream tools require interval format input and therefore fail. When I made the history I manually changed the file format and nom ...
written 6.7 years ago by PaulW50 • updated 6.7 years ago by Dannon Baker3.6k
0
votes
1
answer
439
views
1
answers
Comment: C: Snps And Conservation
... Guru, Thanks, for the handy tip on getting rid of duplicates. The join file now contains 130 items with no duplicates. I guess there is a mismatch between what SNP130 considers a missense mutation and what UCSC Genes considers to be coding sequence. Paul ...
written 6.7 years ago by PaulW50

Latest awards to PaulW

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 75 users visited in the last hour