User: PaulW

gravatar for PaulW
PaulW60
Reputation:
60
Status:
Trusted
Location:
Last seen:
7 months, 2 weeks ago
Joined:
7 years, 4 months ago
Email:
p*******@uni.sydney.edu.au

Posts by PaulW

<prev • 13 results • page 1 of 2 • next >
0
votes
1
answer
264
views
1
answers
Comment: C: 'print reads' throwing 'eof marker is absent' on my BAM file
... Indeed, "best practice" would be to use GATK 3.7. Galaxy servers seems to be dropping support for GATK. It's unclear whether this is driven by the Galaxy team or Broad Institute but it's been written that there are licensing issues. The Institut Curie Galaxy server offers GATK 3. But there's one i ...
written 7 months ago by PaulW60
1
vote
1
answer
264
views
1
answers
Comment: C: 'print reads' throwing 'eof marker is absent' on my BAM file
... Yes, I was wondering if it was a spurious error. I'm trying to apply the recalibration table I created with BaseRecalibrator to my BAM file. ...
written 8 months ago by PaulW60
3
votes
1
answer
264
views
1
answer
'print reads' throwing 'eof marker is absent' on my BAM file
... Yes I've read many of the posts out there about 'BAM EOF absent', but can't find a resolution. I'm working through a DNA analysis. All going fine until I try to run **print reads** which throws: *[bam_header_read] EOF marker is absent. The input is probably truncated. [bam_header_read] invalid BAM ...
bam print reads written 8 months ago by PaulW60
0
votes
2
answers
248
views
2
answers
Answer: A: Where to get SNPs and Indels?
... Thanks for your help. It turns out that Picard ReorderSAM allows sorting the BAM to match the reference file from Broad which then makes everything work fine :-) ...
written 8 months ago by PaulW60
0
votes
2
answers
248
views
2
answers
Where to get SNPs and Indels?
... I downloaded some files from Broad Institute but Realigner Target Creator won't work with these files because the sort order is different to my BAM file. /hg19/Mills_and_1000G_gold_standard.indels.hg19.sites.vcf /hg19/dbsnp_138.hg19.excluding_sites_after_129.vcf /hg19/ucsc.hg19.fasta I can't sort ...
realigner target creator written 8 months ago by PaulW60
0
votes
1
answer
345
views
1
answers
Comment: C: Select FASTQ reads by sequence
... Jenn, Thanks for that interesting suggestion. Unfortunately Lastz doesn't process fastq files. Worse, the galaxy implementation of Lastz apparently doesn't expose the "--ambiguous=iupac" command line option so converting fastq to fasta didn't work. I'll keep searching. There's a couple of things in ...
written 10 months ago by PaulW60
0
votes
1
answer
345
views
1
answers
Comment: C: Select FASTQ reads by sequence
... BTW the FASTQ reads are 150 base Illumina reads ...
written 10 months ago by PaulW60
0
votes
1
answer
345
views
1
answer
Select FASTQ reads by sequence
... Which tool should I use to select all reads from a FASTQ file which include any of about 100 short sequences given in a file such as: ACAGTCAGCTAGCATCGATCCTAGCTAGAC GCATCACGACTACGACGTACATCTAGCATG etc Is there a tool in Galaxy which will do this? Alternatively would BBDUK work for this? ...
fastq written 10 months ago by PaulW60 • updated 10 months ago by Jennifer Hillman Jackson23k
0
votes
1
answer
628
views
1
answer
Processing Gff3 File Of Variants
... Hello all, I have a GFF3 file of variants from nextgen sequencing and want to find non-synonymous changes. Any suggestions? One possible way would be: 1. Use tool "Compute an expression on every row" to extract the reference allele and sample allele from column 9 (attributes column) of the GFF3 f ...
gff written 7.2 years ago by PaulW60 • updated 7.2 years ago by Mary Mangan40
0
votes
1
answer
570
views
1
answers
Comment: C: File Formats In Workflows
... Dannon, Thanks for your interest. It would be a handy feature to be able to attach metadata to tabular files in the workflow. I have shared the workflow. It is called 'chr21 analysis'. Input is a gene BED file for a chromosome region from UCSC data (which includes gene variants). Workflow fails aft ...
written 7.4 years ago by PaulW60

Latest awards to PaulW

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 95 users visited in the last hour