User: c.l.frankling

gravatar for c.l.frankling
Reputation:
10
Status:
New User
Location:
Last seen:
1 week, 4 days ago
Joined:
1 week, 6 days ago
Email:
c************@qmul.ac.uk

Posts by c.l.frankling

<prev • 3 results • page 1 of 1 • next >
0
votes
2
answers
44
views
2
answers
Answer: A: Extracting the read counts from a collapsed fasta file?
... Thank you, that really helped! The collapse tool is really useful for nucleotide sequences, do you know of a way to do this for amino acid sequences in a fasta file still? Thanks again, Charlotte. ...
written 12 days ago by c.l.frankling10
0
votes
1
answer
47
views
1
answer
Way to trim all NGS nucleotide sequences to a specific section
... Is there a way to trim the nucleotide sequence to a specific region? I know you can by base number but what if say for instance I would like to trim to just the open reading frame e.g. >TATAGAAGGGTAATACGACTCACTATAGGGAGTCGCTGCC**ATG**GCCTTGAAAGCCCATCTCGTAACGCCATCATTGGGAGGAGGA and I want to trim ...
galaxy trim nucleotide sequences written 12 days ago by c.l.frankling10 • updated 11 days ago by Jennifer Hillman Jackson23k
2
votes
2
answers
44
views
2
answers
Extracting the read counts from a collapsed fasta file?
... I have collapsed my fastq file so I know have the output fasta file which contains all the unique sequences and their read count information. For example; >1-106 >CTATAGAAGGGTAATACTACGTA >2-88 >CTATAGAAGGGTAATACTAACA >3-83 >CTATAGAAGGGTGACTATTGG How can I create a simple tex ...
galaxy collapse read counts fasta written 13 days ago by c.l.frankling10

Latest awards to c.l.frankling

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 113 users visited in the last hour