User: jjrin

gravatar for jjrin
jjrin10
Reputation:
10
Status:
New User
Location:
Last seen:
1 week, 3 days ago
Joined:
2 weeks, 3 days ago
Email:
l********@yahoo.com

Posts by jjrin

<prev • 4 results • page 1 of 1 • next >
0
votes
1
answer
61
views
1
answers
Comment: C: Duplicated sequences within a gene_id in fasta entry?
... So I tried linearizing the fasta results from Galaxy and it fixed the unequal bases and coordinates issue! I used the answer from here: https://www.biostars.org/p/261820/#262258 Maybe in the future, make Galaxy output the base sequences on a single line rather than many divided lines? It seems to h ...
written 10 days ago by jjrin10
0
votes
1
answer
61
views
1
answers
Comment: C: Duplicated sequences within a gene_id in fasta entry?
... Here is the first gene that appears in the galaxy produced fasta file (gtf annotation/genome fasta file) Scaffold100 StringTie transcript 65415 65755 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; xloc "XLOC_000001"; class_code "u"; tss_id "TSS1"; Scaffold100 StringTie exon 65415 65755 ...
written 12 days ago by jjrin10
5
votes
1
answer
61
views
1
answer
Duplicated sequences within a gene_id in fasta entry?
... Hello, I used the Extract Genomic DNA function in Galaxy and it outputted a fasta file using my original genome fasta and my annotation. However, in each entry of the multifasta file, the sequences are duplicated twice. For example... >gene.1 TATATTTATTAATTTACGGGACTATATTTATTAATTTACGGG ...
rna-seq galaxy extract genomic dna fasta written 12 days ago by jjrin10 • updated 12 days ago by Jennifer Hillman Jackson22k
0
votes
1
answer
49
views
1
answer
Extract Genomic DNA fasta file names?
... Hello, I ran the Extract Genomic DNA feature with my gtf file and reference genome fasta file. The fasta output has the coordinates but has a "?" in place of the gene name. For example, the first gene entry is ">?_Scaffold100_65415_65755_+". Is there something wrong with my gtf reference file f ...
extract genomic dna rna-seq written 17 days ago by jjrin10 • updated 12 days ago by Jennifer Hillman Jackson22k

Latest awards to jjrin

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 63 users visited in the last hour