User: jjrin

gravatar for jjrin
New User
Last seen:
10 months ago
10 months, 2 weeks ago

Posts by jjrin

<prev • 5 results • page 1 of 1 • next >
DEXSeq Error for Conditions
... Hello, I am trying to run DEXSeq and I made all of the count files using your DEXSeq-Count which was successful. The factor I am comparing is "Condition" and factor level 1 is called "GFP" while factor level 2 is called "ICD". These are different variables of my condition. I entered in all of the c ...
deseq2 galaxy dexseq written 10 months ago by jjrin10 • updated 10 months ago by Jennifer Hillman Jackson25k
Comment: C: Duplicated sequences within a gene_id in fasta entry?
... So I tried linearizing the fasta results from Galaxy and it fixed the unequal bases and coordinates issue! I used the answer from here: Maybe in the future, make Galaxy output the base sequences on a single line rather than many divided lines? It seems to h ...
written 10 months ago by jjrin10
Comment: C: Duplicated sequences within a gene_id in fasta entry?
... Here is the first gene that appears in the galaxy produced fasta file (gtf annotation/genome fasta file) Scaffold100 StringTie transcript 65415 65755 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; xloc "XLOC_000001"; class_code "u"; tss_id "TSS1"; Scaffold100 StringTie exon 65415 65755 ...
written 10 months ago by jjrin10
Duplicated sequences within a gene_id in fasta entry?
... Hello, I used the Extract Genomic DNA function in Galaxy and it outputted a fasta file using my original genome fasta and my annotation. However, in each entry of the multifasta file, the sequences are duplicated twice. For example... >gene.1 TATATTTATTAATTTACGGGACTATATTTATTAATTTACGGG ...
rna-seq galaxy extract genomic dna fasta written 10 months ago by jjrin10 • updated 10 months ago by Jennifer Hillman Jackson25k
Extract Genomic DNA fasta file names?
... Hello, I ran the Extract Genomic DNA feature with my gtf file and reference genome fasta file. The fasta output has the coordinates but has a "?" in place of the gene name. For example, the first gene entry is ">?_Scaffold100_65415_65755_+". Is there something wrong with my gtf reference file f ...
extract genomic dna rna-seq written 10 months ago by jjrin10 • updated 10 months ago by Jennifer Hillman Jackson25k

Latest awards to jjrin

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 80 users visited in the last hour