User: jramo033

gravatar for jramo033
jramo0330
Reputation:
0
Status:
New User
Location:
Last seen:
2 months, 4 weeks ago
Joined:
5 months, 2 weeks ago
Email:
j*******@fiu.edu

Posts by jramo033

<prev • 3 results • page 1 of 1 • next >
0
votes
1
answer
132
views
1
answer
Splitting pair end file
... This is the type of file for pair end DNA sequence I have: @MONK:275:C1Y6RACXX:1:1101:1169:1943/1 NAATAAATACTCTAAGACAAATCTATCACTTTAAAAGAGAGAAATCATATTCTAGGTTTTCATTAATGTCAGACTTAGCAGTGAAGATTCTCAGGTTCCT + #4=DFFFFHHHHHJJJJJJIIIJJJJJIJJJJIJJJJIJGJGIJJJJIIJJJJIJJHIJJJJJJJIIJIGIIIJJHIIFIJ ...
split paired fastq written 12 weeks ago by jramo0330 • updated 12 weeks ago by Jennifer Hillman Jackson23k
0
votes
1
answer
109
views
1
answer
Galaxy-using trimmomatics with ChIP seq pair ended (only one file with both reads)
... I am trying to run Trimmomatics in Galaxy under "pair end (as collection)" for afastqsanger.gz file with both reads and I got the message "no fastqsanger.gz dataset collection available". What should I do? split the file into two different files? if so, how can I do it? Is there any other way? ...
chip-seq written 3 months ago by jramo0330 • updated 3 months ago by Jennifer Hillman Jackson23k
1
vote
1
answer
306
views
1
answer
Uploading from local computer a 8.9 Gb fastq file into Galaxy .
... Hello, I am trying to upload a 8.9 GB fastq file into Galaxy from my computer and it looks like working; however, percentage of uploading file keeps being 0 % after 4 hours or so. I have reset / started all over again and I keep getting the same thing (0% after many hours) ...
galaxy written 5 months ago by jramo0330 • updated 5 months ago by Jennifer Hillman Jackson23k

Latest awards to jramo033

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 103 users visited in the last hour