User: jramo033

gravatar for jramo033
jramo03320
Reputation:
20
Status:
New User
Location:
Last seen:
1 month ago
Joined:
1 year, 3 months ago
Email:
j*******@fiu.edu

Posts by jramo033

<prev • 5 results • page 1 of 1 • next >
0
votes
2
answers
95
views
2
answers
Answer: A: Error message when processing htseq-count
... Jen, thank you for your prompt response. How do I import directly to Galaxy from Gencode and iGenomes ( I used "Get data" to import from UCSC but I don't see options for Gencode and iGenomes ) ...
written 5 weeks ago by jramo03320
2
votes
2
answers
95
views
2
answers
Reference Annotation Sources for RNA-seq tools
... When running htseq count, I got this error message: Fatal error: Unknown error occured [bam_sort_core] merging from 9 files and 1 in-memory blocks... Error occured when processing GFF file (line 2 of file /galaxy-repl/main/files/026/998/dataset_26998011.dat): Strand must be'+', '-', or '.'. Th ...
htseq gff3 galaxy gft gff written 5 weeks ago by jramo03320 • updated 5 weeks ago by Jennifer Hillman Jackson25k
0
votes
1
answer
1.0k
views
1
answer
Splitting pair end file
... This is the type of file for pair end DNA sequence I have: @MONK:275:C1Y6RACXX:1:1101:1169:1943/1 NAATAAATACTCTAAGACAAATCTATCACTTTAAAAGAGAGAAATCATATTCTAGGTTTTCATTAATGTCAGACTTAGCAGTGAAGATTCTCAGGTTCCT + #4=DFFFFHHHHHJJJJJJIIIJJJJJIJJJJIJJJJIJGJGIJJJJIIJJJJIJJHIJJJJJJJIIJIGIIIJJHIIFIJ ...
split paired fastq written 13 months ago by jramo03320 • updated 13 months ago by Jennifer Hillman Jackson25k
0
votes
1
answer
348
views
1
answer
Galaxy-using trimmomatics with ChIP seq pair ended (only one file with both reads)
... I am trying to run Trimmomatics in Galaxy under "pair end (as collection)" for afastqsanger.gz file with both reads and I got the message "no fastqsanger.gz dataset collection available". What should I do? split the file into two different files? if so, how can I do it? Is there any other way? ...
chip-seq written 13 months ago by jramo03320 • updated 13 months ago by Jennifer Hillman Jackson25k
1
vote
1
answer
567
views
1
answer
Uploading from local computer a 8.9 Gb fastq file into Galaxy .
... Hello, I am trying to upload a 8.9 GB fastq file into Galaxy from my computer and it looks like working; however, percentage of uploading file keeps being 0 % after 4 hours or so. I have reset / started all over again and I keep getting the same thing (0% after many hours) ...
galaxy written 15 months ago by jramo03320 • updated 15 months ago by Jennifer Hillman Jackson25k

Latest awards to jramo033

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 134 users visited in the last hour