User: Gema Sanz Santos

European Union
Last seen:
1 year ago
5 years, 4 months ago

Posts by Gema Sanz Santos

<prev • 13 results • page 1 of 2 • next >
Answer: A: >90% aligned concordantly 0 times ChIP-seq Bowtie2
... Thank you for your help! Yes, now I'm quite sure the data is single-end. There was a confusion with the file names... they were 2 technical replicates of each samples but they were named as if they were paired and then I got confused. ...
written 13 months ago by Gema Sanz Santos110
Answer: A: >90% aligned concordantly 0 times ChIP-seq Bowtie2
... Hi Jen, thank you for your answer. This is an example of the first reads from TrimGalore output files 1 and 2 (as shown in Galaxy with the "eye" button): **File1:** @HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 1:N:0:CAGATC CCCANGATCTGTTCCACAGGAGATAAGCAGATCTTACTCCAGAGACCACTG + BB ...
written 13 months ago by Gema Sanz Santos110
>90% aligned concordantly 0 times ChIP-seq Bowtie2
... Hi, I know this question have raised many times here and in other forums but I've tried everything other people suggested in previous posts and still can't figure it out where is the problem...... This is the output summary of Bowtie2 (I checked several times the target genome, hg19 and it's correc ...
chip-seq bowtie alignment written 13 months ago by Gema Sanz Santos110
Comment: A: Disk quote limit exceeded
... Thanks! It is solved now :) Best Gema ...
written 18 months ago by Gema Sanz Santos110
Disk quote limit exceeded
... Hello, I exceeded my disk quote limit and it says "Using -314%". Actually, I deleted permanently many things, purged deleted files etc, logout, login again.... deleted cookies... but is still saying Using -314% and I can't run any job. What could be the problem? Thank you very much in advance G ...
disk quote written 18 months ago by Gema Sanz Santos110
Create an admin account to use toolshed and install other programs
... Hello I have to analyse methylation data and I would like to install some tools that I need from toolshed in my account but for that I guess I need an administrator account How can I get one?  Best Gema ...
admin toolshed written 3.3 years ago by Gema Sanz Santos110 • updated 3.3 years ago by fubar1.1k
Nebula Problem
... Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotation and gene annotation in NGS annotation menu) I got always this error despite of the bed file that I use: An error occurred running this job:Unable to run this job due to a cluster error I also got this error mes ...
written 5.3 years ago by Gema Sanz Santos110 • updated 5.3 years ago by Jennifer Hillman Jackson25k
Fw: Error In Annotation Tools
... I edit: Actually I can´t do anything in nebula server, even upload data, I got the cluster error all the time Date: Thursday, May 9, 2013 1:14 PM To: Jennifer Jackson Cc: Subject: Error in annotation tools Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotati ...
galaxy written 5.3 years ago by Gema Sanz Santos110
Comment: C: Problems With Tophat
... Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotation and gene annotation in NGS annotation menu) I got always this error despite of the bed file that I use: An error occurred running this job:Unable to run this job due to a cluster error Could you indicate me how ...
written 5.3 years ago by Gema Sanz Santos110
Problem With Genomespace Exporter
... Dear all, I'm trying to send some data from Galaxy to GenomeSpace, so I can work with this data in Cistrome but I always got this error: GURU MEDITATION: #57662f6109d0460791fa7122116f80ce Internal Server Error Galaxy was unable to sucessfully complete your request An error occurred. This may be a ...
galaxy written 5.3 years ago by Gema Sanz Santos110

Latest awards to Gema Sanz Santos

Popular Question 18 months ago, created a question with more than 1,000 views. For Problem Using Depth Of Coverage (Gatk)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 122 users visited in the last hour