User: Gema Sanz Santos

Reputation:
110
Status:
Trusted
Location:
European Union
Last seen:
1 week ago
Joined:
4 years, 3 months ago
Email:
g*******@gmail.com

Posts by Gema Sanz Santos

<prev • 13 results • page 1 of 2 • next >
2
votes
4
answers
62
views
4
answers
Answer: A: >90% aligned concordantly 0 times ChIP-seq Bowtie2
... Thank you for your help! Yes, now I'm quite sure the data is single-end. There was a confusion with the file names... they were 2 technical replicates of each samples but they were named as if they were paired and then I got confused. ...
written 7 days ago by Gema Sanz Santos110
0
votes
4
answers
62
views
4
answers
Answer: A: >90% aligned concordantly 0 times ChIP-seq Bowtie2
... Hi Jen, thank you for your answer. This is an example of the first reads from TrimGalore output files 1 and 2 (as shown in Galaxy with the "eye" button): **File1:** @HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 1:N:0:CAGATC CCCANGATCTGTTCCACAGGAGATAAGCAGATCTTACTCCAGAGACCACTG + BB ...
written 9 days ago by Gema Sanz Santos110
4
votes
4
answers
62
views
4
answers
>90% aligned concordantly 0 times ChIP-seq Bowtie2
... Hi, I know this question have raised many times here and in other forums but I've tried everything other people suggested in previous posts and still can't figure it out where is the problem...... This is the output summary of Bowtie2 (I checked several times the target genome, hg19 and it's correc ...
chip-seq bowtie alignment written 9 days ago by Gema Sanz Santos110
1
vote
1
answer
185
views
1
answers
Comment: A: Disk quote limit exceeded
... Thanks! It is solved now :) Best Gema ...
written 5 months ago by Gema Sanz Santos110
1
vote
1
answer
185
views
1
answer
Disk quote limit exceeded
... Hello, I exceeded my disk quote limit and it says "Using -314%". Actually, I deleted permanently many things, purged deleted files etc, logout, login again.... deleted cookies... but is still saying Using -314% and I can't run any job. What could be the problem? Thank you very much in advance G ...
disk quote written 5 months ago by Gema Sanz Santos110
0
votes
1
answer
529
views
1
answer
Create an admin account to use toolshed and install other programs
... Hello I have to analyse methylation data and I would like to install some tools that I need from toolshed in my account but for that I guess I need an administrator account How can I get one?  Best Gema ...
admin toolshed written 2.3 years ago by Gema Sanz Santos110 • updated 2.3 years ago by fubar1.1k
0
votes
1
answer
592
views
1
answer
Nebula Problem
... Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotation and gene annotation in NGS annotation menu) I got always this error despite of the bed file that I use: An error occurred running this job:Unable to run this job due to a cluster error I also got this error mes ...
written 4.2 years ago by Gema Sanz Santos110 • updated 4.2 years ago by Jennifer Hillman Jackson22k
0
votes
0
answers
472
views
0
answers
Fw: Error In Annotation Tools
... I edit: Actually I can´t do anything in nebula server, even upload data, I got the cluster error all the time Date: Thursday, May 9, 2013 1:14 PM To: Jennifer Jackson Cc: Subject: Error in annotation tools Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotati ...
galaxy written 4.2 years ago by Gema Sanz Santos110
0
votes
1
answer
704
views
1
answers
Comment: C: Problems With Tophat
... Hello, I'm using Nebula and when I try to use the annotation tools (genomic annotation and gene annotation in NGS annotation menu) I got always this error despite of the bed file that I use: An error occurred running this job:Unable to run this job due to a cluster error Could you indicate me how ...
written 4.2 years ago by Gema Sanz Santos110
0
votes
0
answers
578
views
0
answers
Problem With Genomespace Exporter
... Dear all, I'm trying to send some data from Galaxy to GenomeSpace, so I can work with this data in Cistrome but I always got this error: GURU MEDITATION: #57662f6109d0460791fa7122116f80ce Internal Server Error Galaxy was unable to sucessfully complete your request An error occurred. This may be a ...
galaxy written 4.3 years ago by Gema Sanz Santos110

Latest awards to Gema Sanz Santos

Popular Question 5 months ago, created a question with more than 1,000 views. For Problem Using Depth Of Coverage (Gatk)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 63 users visited in the last hour