Question: Fastq Splitter Produced Empty Dataset, Please Help
0
gravatar for Du, Jianguang
6.3 years ago by
Du, Jianguang • 380
Du, Jianguang • 380 wrote:
I have problem to split a paired-end FASTQ dataset into two separate datasets. In order to explain the problem clearly, I list the detail of what I did with my dataset: Step 1) My aim is to compare datasets for the differential alternative splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as original data. Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, Does this dataset look OK? @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 I28II;II*2/<5:++,(..*943F@I.('+.35' @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 9+*9+7@?F1206,IGI+D122&/0++-.>+6/@? Step 2) Then I performed FASTQ groomer at setting as follows: a) Input FASTQ quality scores type: Illumina 1.3-1.7 b)Advanced Options: Hide Advanced Options. Did I choose the right setting for FASTQ groomer? Should I use Advanced Options? If yes, what is the setting for Advances Options? Below is part of groomed dataset: @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 *!!**!**!!!!!!!!!!!!!!!!'!*!!!!!!!! @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 !!!!!!!!'!!!!!*(*!%!!!!!!!!!!!!!!!! Does the groomed data look right? Is number represnting the member of a pair correct? Here they are ".1" and ".2", should they be "/1" and "/2"? Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting for the splitter. I chose the right groomed file and then click "Excute". Below is the description of the splitted dataset: empty format: fastqsanger, database:hg19 Info: Split 0 of 15277248 reads (0.00%). Please help me dela with this problem. Thanks. Jianguang Du
• 1.0k views
ADD COMMENT • link • modified 6.3 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.3 years ago by Du, Jianguang • 380
0
gravatar for Jennifer Hillman Jackson
6.3 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello Jianguang, Your data is paired end, but it was already split into forward and reverse reads when extracted in FASTQ format from the SRA. The tool 'FASTQ splitter' is not needed (this tool literally cuts a joined sequence record into two). What you most likely want to do instead is sort out the forward and reverse reads into separate datasets. The tool 'Manipulate FASTQ' in the same tool group would be a good choice. All of the sequences ending in a ".1" are forward, ending in a ".2" are reverse. Run the tool twice on your dataset. You do not need run 'FASTQ Groomer' on this data. According to the SRA report, the sequencing technology already produced Phred+33 scaled base calls. This means that you can simply assign the datatype to be "fastqsanger" to have it be recognized by the FASTQ tools. Do this as a first step, before 'Manipulate FASTQ', on the original data. Are you working on the Galaxy Main instance at http://main.g2.bx.psu.edu (http://usegalaxy.org)? If you need more help, please share your history with the question. Use "Options (gear icon) -> Share of Publish", generate a share link, and then email the galaxy-bugs@bx.psu.edu mailing list instead (to keep your history private, is an internal list to our team only). But, hopefully this helps to resolve the issues! Jen Galaxy team -- Jennifer Jackson http://galaxyproject.org
ADD COMMENT • link written 6.3 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 172 users visited in the last hour