Question: How To Clip Multiple Adapter Sequences In Penn State Galaxy? Thank.
0
Binbin You • 50 wrote:
Hi All,
In " Clip adapter sequences" option of Penn State Galaxy, I choose
"Enter custom sequence" under "Source", and I can only enter One
custom clipping sequence. So how can I enter another 3 adapter
sequences which I want to clip.
In addition, In "What it does" it shows: This tool clips adapters
from the 3'-end of the sequences in a FASTA/FASTQ file.
So how could i do if I have the adapter sequences like this:
5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT
5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
5' GACGGCATACGAGCTCTTCCGATCT
5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much for any response!
Best wishes,
Bin
ADD COMMENT
• link
•
modified 7.2 years ago
by
Jennifer Hillman Jackson ♦ 25k
•
written
7.2 years ago by
Binbin You • 50
