Question: Metadata error while mapping with bowtie in galaxy
0
gravatar for aritrancbs.research
14 months ago by
aritrancbs.research • 10 wrote:

ChIP seq files sequenced in Sanger / illumina 1.9, when processed for mapping with Bowtie for Illumina, showed the following error: "Required metadata values are missing. Some of these values may not be editable by the user. Selecting "Auto-detect" will attempt to fix these values."

Further info said: "Error aligning sequence. Error: reads file does not look like a FASTQ file terminate called after throwing an instance of 'int' /bin/sh: line 1: 9127 Aborted (core dumped) bowtie -q -p 6 -S -n 2 -e 70 -l 28 --maxbts 125 -k 1 -m 1 --phred" Why is it showing this?

While uploading the file through FTP, i had by mistake selected the format type to be Fastq.gz. But later i went to the file attributes and changed the data type to fastqsanger. Is there something to do with this?

For the time being, Metadata is in auto detection mode. But it has been like that for the past 1 hr. What should i do?

chip-seq • 454 views
ADD COMMENT • link • modified 14 months ago by valdirbarth • 0 • written 14 months ago by aritrancbs.research • 10
0
gravatar for valdirbarth
14 months ago by
valdirbarth • 0 wrote:

Can you click on the "view data" button of your fastq file to see if it is in the right format (and maybe paste it here)?

It should look like this:

@NB500989:78:H7WTMBGXY:1:11101:8576:1097 1:N:0:ACTTGA
GATCTACCCATGGCCAGGGTGAAGCACGGGCCCT
+
EEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEE

Is it possible the the first character of your fastq file is a number instead of @?

ADD COMMENT • link modified 14 months ago • written 14 months ago by valdirbarth • 0
0
gravatar for Jennifer Hillman Jackson
14 months ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:

The peak view for a compressed fastq will look like uncompressed. Was the original file .gz compressed or uncompressed? The datatype needs to match the actual content. Reload the data using metadata autodetect if all else fails.

Understanding compressed fastq data (fastq.gz)

Thanks, Jen, Galaxy team

ADD COMMENT • link written 14 months ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 169 users visited in the last hour