Question: Galaxy'S Recent Problems
0
gravatar for Dave Clements
7.6 years ago by
Dave Clements ♦♦ 2.5k
United States
Dave Clements ♦♦ 2.5k wrote:
Hello all, Galaxy has been ill recently due to disk space on the server filling up. In the short term we are working on freeing up space. In the longer term we are working on adding a quota system to limit how much space any one user can take, and we've also ordered a lot more disk. In the mean time, *please take a look at your saved histories and datasets and delete anything you no longer need*. This will greatly help us get through the current rough patch. In the longer term, you can also consider setting up your own local Galaxy instance, or running Galaxy on the cloud. See: http://getgalaxy.org/ https://bitbucket.org/galaxy/galaxy-central/wiki/cloud Thanks for your patience while we work this out, Dave C and the Galaxy Team -- http://galaxy.psu.edu/gcc2011/ http://getgalaxy.org http://usegalaxy.org/
galaxy • 831 views
ADD COMMENT • link • modified 7.6 years ago by kenlee nakasugi • 60 • written 7.6 years ago by Dave Clements ♦♦ 2.5k
0
gravatar for kenlee nakasugi
7.6 years ago by
kenlee nakasugi • 60 wrote:
Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb.... seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.fa>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA >ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGC >ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.fa>ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTT>ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAG>ILLUMINA- 08A740_0000:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGCCCCGTCAGTCCCGCCA Any ideas? Thanks, Ken
ADD COMMENT • link written 7.6 years ago by kenlee nakasugi • 60
Apologies for the long content.. I seem to be having a discrepancy with fastx_collapser as well. I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 26580941 sequences (representing 212647528 reads) ---> what the..?Output: 3177400 sequences (representing 212647528 reads) In my collapsed file, my top read is: >1-35820208TACCTGGTTGATCCTGCCAGTAG (this is already over my original read count) When I grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566 .... Ok, I've reanalyzed a previous dataset and the output is consistent with my previous numbers: fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 sequences (representing 36008043 reads)Output: 3886503 sequences (representing 36008043 reads) so it doesn't appear to be the toolkit. How are the tools counting "reads" and "sequences" ?Could the format of the headers affect it? hyphens vs underscores? This data set:>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA Previous data set:>GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA Thanks To: galaxy-user@bx.psu.edu Date: Thu, 14 Apr 2011 00:54:05 +0000 Subject: [galaxy-user] regarding read counts from fastx_clipper Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb.... seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.fa>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA >ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGC >ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.fa>ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTT>ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAG>ILLUMINA- 08A740_0000:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGCCCCGTCAGTCCCGCCA Any ideas? Thanks, Ken ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
ADD REPLY • link written 7.6 years ago by kenlee nakasugi • 60
Could someone take a look at this history in Galaxy? http://main.g2.bx.psu.edu/u/kenaka/h/count-issue collapser is not reporting the correct counts in the output for one of my files. seqdata1 and seqdata2 should both have 50 reads. Yet it is reporting more reads for seqdata1 in both the verbose reporting and the output. I have the same issue with the fastx_toolkit, as per below. What could be the cause? Thanks.Ken To: galaxy-user@bx.psu.edu Date: Thu, 14 Apr 2011 03:12:14 +0000 Subject: Re: [galaxy-user] regarding read counts from fastx_clipper Apologies for the long content.. I seem to be having a discrepancy with fastx_collapser as well. I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 26580941 sequences (representing 212647528 reads) ---> what the..?Output: 3177400 sequences (representing 212647528 reads) In my collapsed file, my top read is: >1-35820208TACCTGGTTGATCCTGCCAGTAG (this is already over my original read count) When I grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566 .... Ok, I've reanalyzed a previous dataset and the output is consistent with my previous numbers: fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 sequences (representing 36008043 reads)Output: 3886503 sequences (representing 36008043 reads) so it doesn't appear to be the toolkit. How are the tools counting "reads" and "sequences" ?Could the format of the headers affect it? hyphens vs underscores? This data set:>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA Previous data set:>GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA Thanks To: galaxy-user@bx.psu.edu Date: Thu, 14 Apr 2011 00:54:05 +0000 Subject: [galaxy-user] regarding read counts from fastx_clipper Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb.... seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.fa>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA >ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGC >ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.fa>ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTT>ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAG>ILLUMINA- 08A740_0000:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGCCCCGTCAGTCCCGCCA Any ideas? Thanks, Ken ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
ADD REPLY • link written 7.6 years ago by kenlee nakasugi • 60
I've pinpointed the cause to be a hyphen followed by a numeric in the fasta header: if the header is: then the read counts will not be accurate in the collapsed output. After the '>ILLUMINA', if I replace the -08 with _08, or delete the numbers so that it is -A740, then the count output is as expected. Only appears to apply to the second field after the first delimiter. Not sure if this is a known issue. To: galaxy-user@bx.psu.edu Date: Fri, 15 Apr 2011 00:29:49 +0000 Subject: [galaxy-user] Read count issue with clipper/collapser Could someone take a look at this history in Galaxy? http://main.g2.bx.psu.edu/u/kenaka/h/count-issue collapser is not reporting the correct counts in the output for one of my files. seqdata1 and seqdata2 should both have 50 reads. Yet it is reporting more reads for seqdata1 in both the verbose reporting and the output. I have the same issue with the fastx_toolkit, as per below. What could be the cause? Thanks.Ken To: galaxy-user@bx.psu.edu Date: Thu, 14 Apr 2011 03:12:14 +0000 Subject: Re: [galaxy-user] regarding read counts from fastx_clipper Apologies for the long content.. I seem to be having a discrepancy with fastx_collapser as well. I have converted from s_8_sequence_clipped.fa to s_8_sequence_collapsed.fa fastx_collapser -v -i s8_sequence_clipped.fa -o s8_sequence_collapsed.faInput: 26580941 sequences (representing 212647528 reads) ---> what the..?Output: 3177400 sequences (representing 212647528 reads) In my collapsed file, my top read is: >1-35820208TACCTGGTTGATCCTGCCAGTAG (this is already over my original read count) When I grep -e TACCTGGTTGATCCTGCCAGTAG -c s_8_sequence_clipped.fa 4,503,566 .... Ok, I've reanalyzed a previous dataset and the output is consistent with my previous numbers: fastx_collapser -v -i s3-sequence.fa -o s4-sequence-RETEST.faInput: 36008043 sequences (representing 36008043 reads)Output: 3886503 sequences (representing 36008043 reads) so it doesn't appear to be the toolkit. How are the tools counting "reads" and "sequences" ?Could the format of the headers affect it? hyphens vs underscores? This data set:>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA Previous data set:>GAPC_0034_FC:1:1:1548:1028#0/1AAACTTCATCGTTATCGAGCGA Thanks To: galaxy-user@bx.psu.edu Date: Thu, 14 Apr 2011 00:54:05 +0000 Subject: [galaxy-user] regarding read counts from fastx_clipper Hi, I'm using the fastx_toolkit (v0.0.13) command line scripts. When using fastx_clipper, I get: fastx_clipper -a TCGTATGCCGTCTTCTGCTTG -v -c -l 15 -M 5 -i s_8_sequence.fa -o s_8_sequence_clipped.faClipping Adapter: TCGTATGCCGTCTTCTGCTTGMin. Length: 15Non-Clipped reads - discarded.Input: 227673720 reads.Output: 212647528 reads.discarded 3527200 too-short reads.discarded 725608 adapter-only reads.discarded 10773384 non-clipped reads.discarded 0 N reads. The s_8_sequence.fa file is 2.2Gb, s_8_sequence_clipped.fa file is 1.7Gb.... seems like fastx_clipper is reporting way too many reads in this instance. I also tried without the -M option but same thing. I checked with: wc -l s_8_sequence.fa56918430(divide this by 2 gives 28,459,215 reads) wc -l s_8_sequence_clipped.fa53161882(divided by 2 gives 26,580,941 reads) There has never been such a discrepancy with this tool. I'm not sure if I'm doing something silly this time round, or somethings changed in my system that's affecting fastx_clipper counting. Heres a couple of lines from input and output: head -n 6 s_8_sequence.fa>ILLUMINA- 08A740_0000:8:1:1736:1055#0/1GCGAGCGTAGTTCAATGGTAAAACATCTCCTTGCCAAGGA >ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTTTCGTATGCCGTCTTCTGC >ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAGTCGTATGCCGTCTTCTG head -n 6 s_8_sequence_clipped.fa>ILLUMINA- 08A740_0000:8:1:2219:1057#0/1CAAGCGTCGGAGGTTTAGTCTT>ILLUMINA- 08A740_0000:8:1:2316:1056#0/1TACCTGGTTGATCCTGCCAGTAG>ILLUMINA- 08A740_0000:8:1:3041:1059#0/1GAAGCTGCGGGTTCGAGCCCCGTCAGTCCCGCCA Any ideas? Thanks, Ken ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
ADD REPLY • link written 7.6 years ago by kenlee nakasugi • 60
Hi Kanlee, Not sure if you have been replied to about this yet (there were a few different emails about this issue), but the FASTX-Tool authors are going to fix this bug in the next release. It will be incorporated into Galaxy after then. Thanks for reporting the problem, the details were very helpful! Best, Jen Galaxy team -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org
ADD REPLY • link written 7.6 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 179 users visited in the last hour