Question: Fastq To Fastqsanger Using Groomer Question
gravatar for David K Crossman
7.4 years ago by
United States
David K Crossman130 wrote:
Hello! I am fairly new to using Galaxy and have a question about the FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just recently generated from Illumina's NGS instruments. I am aware that the first step to perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the "Input FASTQ quality scores type" box. However, if I look at the raw data reads, I notice that Line 4 (which encodes the quality values for sequence in Line 2) has values outside of the Illumina 1.3+ range (some of them fall into the Sanger format. I am enclosing the Quality Score Comparison figure along with some of the raw RNA-Seq data): Quality Score Comparison SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSS ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIII ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXX !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdef ghijklmnopqrstuvwxyz{|}~ | | | | | | 33 59 64 73 104 126 S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads) I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads) X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads) Diagram adapted from RNA-Seq raw data @HWI-ST156_294:7:1:1058:2165:0/1 CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC + HHHHFGGHHHGFHHFHHEGHC<gggeb.ee9d?ddeeee4fffcbb .c="D" @hwi-st156_294:7:1:1184:2191:0="" 1="" cgtaaatccatgtctgacttctggatagcaaacaccagcaccgcgtggatg="" +="" ee;e="ECEEBE@EEEE=GBFGF/GFFC&lt;FA;:@&lt;8AEABB">A######### @HWI-ST156_294:7:1:1018:2200:0/1 NCTGATTAAGGATAATGAGTTTTTAGTAGAACTAATGATGTTATTCCTTGG + ################################################### @HWI-ST156_294:7:1:1225:2217:0/1 GTTTTTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA + FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?############ As a test in FASTQ Groomer, I chose either the Sanger or Illumina 1.3+ as the input quality scores type and these are the results I got: FASTQ Groomer on tn-read1 (using Sanger as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: 2 - 40 FASTQ Groomer on tn-read1 (using Illumina1.3+ as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: -29 - 9 Which one is right (I presume the Illumina 1.3+ one, but I can't find any sort of explanation)? I noticed that the "input decimal range" had different values (although they spanned the same length) in relation to which input was chosen. What would happen downstream in TopHat if Sanger was used instead of Illumina 1.3+ for these files? Is there any other reading material/websites/etc... out there that might help me better understand the quality score and which to use? Any info/help would be greatly appreciated. Thanks, David David K. Crossman, Ph.D. Systems Biologist/Analyst/Statistician Heflin Center for Genomic Science University of Alabama at Birmingham 720 20th Street South Kaul Room 420 Birmingham, AL 35294-0024 (205) 996-4045 (205) 996-4056 (fax) David K. Crossman, Ph.D.<> Heflin Center for Genomic Science<http:""/>
gff • 5.3k views
ADD COMMENTlink modified 7.4 years ago by Peter Cock1.4k • written 7.4 years ago by David K Crossman130
gravatar for Daniel Blankenberg
7.4 years ago by
Daniel Blankenberg ♦♦ 1.7k
United States
Daniel Blankenberg ♦♦ 1.7k wrote:
Hi David, Your files appear to be of the Sanger FASTQ variant. As you have noticed, the info blurb provided by the Grooming tool provides information that should be utilized to confirm input types. While the 'Illumina 1.3+' FASTQ format does encode scores using a different ASCII range, it is my understanding that the scripts provided by the manufacturer to create FASTQ formatted files were enhanced to write out Sanger encoded quality scores. The correct Grooming path for your data is Sanger --> Sanger. Please let us know if we can provide further assistance. Thanks for using Galaxy, Dan
ADD COMMENTlink written 7.4 years ago by Daniel Blankenberg ♦♦ 1.7k
gravatar for Peter Cock
7.4 years ago by
Peter Cock1.4k
European Union
Peter Cock1.4k wrote:
Very recently? If they are already using Illumina's CASAVA v1.8 pipeline then the FASTQ files will already be in the Sanger FASTQ format: Peter
ADD COMMENTlink written 7.4 years ago by Peter Cock1.4k
Illumina's technical support team told me two weeks ago that Cassava 1.8 will not be released for at least six weeks. That makes it at least a month from now. Do you know anyone outside the company that has used it yet? Beyond the moaning within the cited seqanswers thread, I'd be interested in hearing any first-hand impressions. Eric
ADD REPLYlink written 7.4 years ago by Eric Cabot20
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 115 users visited in the last hour