Question: galaxy can't read the fastq data
0
gravatar for weiming.chen
3.4 years ago by
weiming.chen0 wrote:

I have uploaded some of ChIP-seq compressed as gz to Galaxy. After uploading, those gz file become as fastq format automatically. I don't have any idea why Galaxy couldn't run those fastq files on embedded tools like BWA except for FastQC.

Did I miss some things? Could anyone know how to do?

Here is some reads in Fastq of my chip-seq:

@HISEQ:163:HBBYRADXX:2:1101:1396:2085 2:N:0:ACACGA
ACAATGCCGACTGTTCAGCCATGGATAGTCCTTTGCTTTATCTGCTTCTA
+
BBBFFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFFFIIII
@HISEQ:163:HBBYRADXX:2:1101:1404:2105 2:N:0:ACACGA
ACAGGCACCTGCCACCATGCCCAGCTAATTTTTATATTTTTAGTAGAGAT
+
BBBFFFFFFFFFFIIIIIFIIIIIIIFIFIIIIIIFFFIBIIFBFIFFII
@HISEQ:163:HBBYRADXX:2:1101:1495:2196 2:N:0:ACACGA
AATCTCGAACCCAGGAGGTGGAGGATGCAGTGAGCCAAGATCGCACAACT
+
BBBFFFFFFFFFFIIIFFFFFIIIIIIIIIFIIIIIIIIIIIIIFIIIIF
@HISEQ:163:HBBYRADXX:2:1101:1522:2023 2:N:0:ACACGA
GCAAAGTATAAAAGAAGAAGAAGGAGTGGGAAGAGCGCTGTAGGAAGATT
+
0<0000000<00<B000000<<0<0B0<B#####################
@HISEQ:163:HBBYRADXX:2:1101:1546:2036 2:N:0:ACACGA
CTCTTGCGCCTTCCTAGCGGCGATGTTGTCCGGGTGGTAGCGACTGCGCG
+
BBBFFFFFFFFFFIIIIIIIIIIIIBFFIBFIFI<FFBFFFFFFFFFFFB

Wei-Ming

mapping bwa bowtie galaxy chip-seq • 873 views
ADD COMMENTlink modified 3.4 years ago • written 3.4 years ago by weiming.chen0
2
gravatar for Bjoern Gruening
3.4 years ago by
Bjoern Gruening5.1k
Germany
Bjoern Gruening5.1k wrote:

Hi,

you need to strictly define the correct datatype. For example fastqsanger. Read more about this problem here: http://wiki.galaxyproject.org/Support#Tool_doesn.27t_recognize_dataset

Cheers,

Bjoern

ADD COMMENTlink written 3.4 years ago by Bjoern Gruening5.1k
0
gravatar for weiming.chen
3.4 years ago by
weiming.chen0 wrote:

Hi Bojem

Thanks you very much. It works as well now.

I am just curious about format between Fastq and Fastqsenger. They looks the same. I am no idea why it require to convert the Fastq to Fastqsenger format. Is it a way to avoid the different formats in different NSG instrument? 

Thanks,

Wei-Ming

ADD COMMENTlink written 3.4 years ago by weiming.chen0
1

You can ask your sequence facility, if you want to be sure. Normally, all fastq file produces in the last year should be fastqsanger. The old formats are deprecated since years. Nevertheless, you will find them in various archives.
 

ADD REPLYlink written 3.4 years ago by Bjoern Gruening5.1k

Got it, thanks you.

ADD REPLYlink written 3.4 years ago by weiming.chen0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 112 users visited in the last hour