Question: Inconsistent Sequences
0
gravatar for Melissa Wilson
12.4 years ago by
Melissa Wilson • 20 wrote:
Can anyone help figure out the following problem? I am interested in the exon positions and sequences of EIF1AX. I used Galaxy to find the coding exon positions through UCSC (RefSeq gene NM_001412) using the hg18 (and subsequently hg17 and hg16) sequences. Then I used Fetch Sequences and Alignments to Extract genomic DNA corresponding to query coordinates. The functions work well on the surface, and while there are 435nt extracted for the EIF1AX cds the composition of those 435nt is not the same as the 435nt I get from NCBI NM_001412 CDS nor when I go through UCSC directly to extract the CDS for EIF1AX. This is the same for hg17 and then almost the same for hg16 except for a few additional exons (not clear about those). Perhaps I'm running my search incorrectly, but would someone please check this out. I think a fresh view might clarify things. Best, Melissa
galaxy • 860 views
ADD COMMENT • link • modified 12.4 years ago by Yi Zhang • 90 • written 12.4 years ago by Melissa Wilson • 20
0
gravatar for Yi Zhang
12.4 years ago by
Yi Zhang • 90
Yi Zhang • 90 wrote:
Dear Melissa, Sorry for the late reply. After following what you had done on galaxy, galaxy got the genomic DNA for RefSeq gene NM_001412(hg17): ATCTAA CTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATT CAGTTTGATGACATTGGAGATGATGATGAAGATATTGATGAC GATAACAAAGCTGATGTAATTTTAAAATACAATGCAGACGAAGCTAGAAG TCTGAAGGCATACGGCGAGCTTCCAGAGCATG GTTTGGATAAATACCTCGGACATTATTTTGGTTGGTCTCCGAGACTACCA G AGTATGCTCAGGTAATCAAAATGTTGGGAAATGGACGGCTAGAAGCAATG TGTTTCGATGGTGTAAAGAGGTTATGTCACATCAGAGGAAAATTGAGAAA AAAG GTAAAGGAGGTAAAAACAGACGCAGGGGTAAGAATGAGAATGAATCTGAA AAAAGAGAACTGGTATTCAAAGAGGATGGTCAGG ATGCCCAAGAATAAAG The result is same as UCSC. What I have done is: 1. use galaxy to find the coding exons through UCSC, the result is: chrX 19906080 19906086 NM_001412_cds_0_0_chrX_19906081_r 0 - chrX 19908290 19908382 NM_001412_cds_1_0_chrX_19908291_r 0 - chrX 19909956 19910038 NM_001412_cds_2_0_chrX_19909957_r 0 - chrX 19911731 19911782 NM_001412_cds_3_0_chrX_19911732_r 0 - chrX 19913512 19913616 NM_001412_cds_4_0_chrX_19913513_r 0 - chrX 19916313 19916397 NM_001412_cds_5_0_chrX_19916314_r 0 - chrX 19919399 19919415 NM_001412_cds_6_0_chrX_19919400_r 0 - 2. Use tool "Extract genomic DNA" under the "Fetch Sequences and Alignments" to get DNAs. Thank you for using galaxy in your research work. If you have other questions, please let us know. Sincerely, Yi Zhang
ADD COMMENT • link written 12.4 years ago by Yi Zhang • 90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 171 users visited in the last hour